Morpholino

MO1-itgb8

ID

ZDB-MRPHLNO-120907-1

Name

MO1-itgb8

Previous Names

itgb8e2i2 MO (1)

Target

itgb8 (1)

Sequence

5' - GCGCTCTGGCATACATTACCTCCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-itgb8

No data available

Phenotype

Phenotype resulting from MO1-itgb8

Phenotype	Fish	Figures
brain hemorrhagic, abnormal	TL + MO1-itgb8	Fig. 4 from Hirota et al., 2015 Fig. 3 from Liu et al., 2012
brain hydrocephalic, abnormal	TL + MO1-itgb8	Fig. 3 from Liu et al., 2012
brain vasculature development process quality, abnormal	WT + MO1-itgb8 + MO4-tp53	Fig. 4 from Hirota et al., 2015
brain vasculature broken, abnormal	WT + MO1-itgb8 + MO4-tp53	Fig. 4 from Hirota et al., 2015 Fig. 3 from Liu et al., 2012

Phenotype of all Fish created by or utilizing MO1-itgb8

Phenotype	Fish	Conditions	Figures
brain vasculature broken, abnormal	TL + MO1-itgb8	standard conditions	Fig. 3 from Liu et al., 2012
brain hemorrhagic, abnormal	TL + MO1-itgb8	standard conditions	Fig. 3 from Liu et al., 2012
brain hydrocephalic, abnormal	TL + MO1-itgb8	standard conditions	Fig. 3 from Liu et al., 2012
brain vasculature development process quality, abnormal	WT + MO1-itgb8 + MO4-tp53	control	Fig. 4 from Hirota et al., 2015
brain hemorrhagic, abnormal	WT + MO1-itgb8 + MO4-tp53	control	Fig. 4 from Hirota et al., 2015
brain vasculature broken, abnormal	WT + MO1-itgb8 + MO4-tp53	control	Fig. 4 from Hirota et al., 2015
brain vasculature broken, abnormal	TL + MO1-itgb8 + MO4-itgav	standard conditions	Fig. 3 from Liu et al., 2012
brain hemorrhagic, abnormal	TL + MO1-itgb8 + MO4-itgav	standard conditions	Fig. 3 from Liu et al., 2012
brain vasculature broken, abnormal	WT + MO1-itgb8 + MO4-tp53 + MO8-nrp1a	control	Fig. 4 from Hirota et al., 2015
brain vasculature development process quality, abnormal	WT + MO1-itgb8 + MO4-tp53 + MO8-nrp1a	control	Fig. 4 from Hirota et al., 2015
brain hemorrhagic, abnormal	WT + MO1-itgb8 + MO4-tp53 + MO8-nrp1a	control	Fig. 4 from Hirota et al., 2015
central artery decreased length, abnormal	la116Tg + MO1-itgb8 + MO4-itgav	standard conditions	Fig. 6 from Liu et al., 2012
central artery direction, abnormal	la116Tg + MO1-itgb8 + MO4-itgav	standard conditions	Fig. 6 from Liu et al., 2012
central artery unlumenized, abnormal	la116Tg + MO1-itgb8 + MO4-itgav	standard conditions	Fig. 6 from Liu et al., 2012
central artery irregular spatial pattern, abnormal	la116Tg + MO1-itgb8 + MO4-itgav	standard conditions	Fig. 6 from Liu et al., 2012
brain vasculature has fewer parts of type central artery, abnormal	la116Tg + MO1-itgb8 + MO4-itgav	standard conditions	Fig. 6 from Liu et al., 2012
central artery morphology, abnormal	la116Tg + MO1-itgb8 + MO4-itgav	standard conditions	Fig. 6 from Liu et al., 2012
endothelial cell proliferation decreased occurrence, abnormal	la116Tg + MO1-itgb8 + MO4-itgav	standard conditions	Fig. 8 from Liu et al., 2012
angiogenesis disrupted, abnormal	la116Tg + MO1-itgb8 + MO4-itgav	standard conditions	Fig. 6 from Liu et al., 2012
pharyngeal vasculature has fewer parts of type vascular associated smooth muscle cell, abnormal	ca7Tg; ci5Tg + MO1-itgb8 + MO4-itgav	standard conditions	Fig. S5 from Liu et al., 2012
ventral aorta has fewer parts of type vascular associated smooth muscle cell, abnormal	ca7Tg; ci5Tg + MO1-itgb8 + MO4-itgav	standard conditions	Fig. S5 from Liu et al., 2012

Citations