Morpholino

MO1-ajuba

ID
ZDB-MRPHLNO-120821-5
Name
MO1-ajuba
Previous Names
None
Target
Sequence
5' - TGAGTTTGATGCCAAGTCGATCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ajuba
Expressed Gene Anatomy Figures
bmp4 Fig. 5 with image from Witzel et al., 2012
isl1a Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Witzel et al., 2012
mef2ca Fig. 5 with image from Witzel et al., 2012
mef2cb Fig. 5 with image from Witzel et al., 2012
nkx2.5 Fig. 7 with image from Witzel et al., 2012
tbx1 Fig. 5 with image from Witzel et al., 2012
tbx20 Fig. 5 with image from Witzel et al., 2012
Phenotype
Phenotype resulting from MO1-ajuba
Phenotype Fish Figures
anterior lateral plate mesoderm tbx1 expression increased distribution, abnormal WT + MO1-ajuba Fig. 5 with image from Witzel et al., 2012
anterior lateral plate mesoderm mef2cb expression increased distribution, abnormal WT + MO1-ajuba Fig. 5 with image from Witzel et al., 2012
anterior lateral plate mesoderm isl1a expression increased distribution, abnormal WT + MO1-ajuba Fig. 5 with image from Witzel et al., 2012
anterior lateral plate mesoderm tbx20 expression increased distribution, abnormal WT + MO1-ajuba Fig. 5 with image from Witzel et al., 2012
anterior lateral plate mesoderm mef2ca expression increased distribution, abnormal WT + MO1-ajuba Fig. 5 with image from Witzel et al., 2012
atrium orientation cardiac ventricle, abnormal f2Tg; s883Tg + MO1-ajuba Fig. 3 with image from Witzel et al., 2012
atrium cardiac muscle cell increased amount, abnormal f2Tg; s883Tg + MO1-ajuba Fig. 3 with image from Witzel et al., 2012
atrium cardiac muscle cell ab2-isl labeling increased distribution, abnormal s883Tg + MO1-ajuba Fig. 4 with image from Witzel et al., 2012
cardiac muscle cell increased amount, abnormal s883Tg + MO1-ajuba Fig. 4 with image from Witzel et al., 2012
cardiac ventricle cardiac muscle cell increased amount, abnormal s883Tg + MO1-ajuba Fig. 3 with image from Witzel et al., 2012
determination of heart left/right asymmetry disrupted, abnormal s883Tg + MO1-ajuba Fig. 3 with image from Witzel et al., 2012
heart isl1a expression increased distribution, abnormal s883Tg + MO1-ajuba Fig. 4 with image,  Fig. 6 with image from Witzel et al., 2012
heart increased size, abnormal f2Tg; s883Tg + MO1-ajuba Fig. 3 with image from Witzel et al., 2012
heart contraction decreased rate, abnormal f2Tg; s883Tg + MO1-ajuba text only from Witzel et al., 2012
heart primordium nkx2.5 expression decreased distribution, abnormal WT + MO1-ajuba Fig. 7 with image from Witzel et al., 2012
heart primordium bmp4 expression increased distribution, abnormal WT + MO1-ajuba Fig. 5 with image from Witzel et al., 2012
heart rudiment ab2-isl labeling increased distribution, abnormal s883Tg + MO1-ajuba Fig. 4 with image from Witzel et al., 2012
heart rudiment peripheral region ab2-isl labeling increased distribution, abnormal s883Tg + MO1-ajuba Fig. 4 with image from Witzel et al., 2012
heart tube ab2-isl labeling increased distribution, abnormal s883Tg + MO1-ajuba Fig. 4 with image from Witzel et al., 2012
heart tube peripheral region ab2-isl labeling increased distribution, abnormal s883Tg + MO1-ajuba Fig. 4 with image from Witzel et al., 2012
pericardium edematous, abnormal s883Tg + MO1-ajuba Fig. 3 with image from Witzel et al., 2012
primitive heart tube GFP expression increased distribution, abnormal ncv11Tg; ncv47Tg + MO1-ajuba Fig. 2 with image from Fukui et al., 2018
Phenotype of all Fish created by or utilizing MO1-ajuba
Phenotype Fish Conditions Figures
anterior lateral plate mesoderm isl1a expression increased distribution, abnormal WT + MO1-ajuba standard conditions Fig. 5 with image from Witzel et al., 2012
anterior lateral plate mesoderm mef2cb expression increased distribution, abnormal WT + MO1-ajuba standard conditions Fig. 5 with image from Witzel et al., 2012
heart isl1a expression increased distribution, abnormal WT + MO1-ajuba standard conditions Fig. 6 with image from Witzel et al., 2012
anterior lateral plate mesoderm tbx1 expression increased distribution, abnormal WT + MO1-ajuba standard conditions Fig. 5 with image from Witzel et al., 2012
heart primordium nkx2.5 expression decreased distribution, abnormal WT + MO1-ajuba standard conditions Fig. 7 with image from Witzel et al., 2012
anterior lateral plate mesoderm mef2ca expression increased distribution, abnormal WT + MO1-ajuba standard conditions Fig. 5 with image from Witzel et al., 2012
anterior lateral plate mesoderm tbx20 expression increased distribution, abnormal WT + MO1-ajuba standard conditions Fig. 5 with image from Witzel et al., 2012
heart isl1a expression increased distribution, abnormal WT + MO1-ajuba chemical treatment: all-trans-retinoic acid Fig. 6 with image from Witzel et al., 2012
heart primordium bmp4 expression increased distribution, abnormal WT + MO1-ajuba standard conditions Fig. 5 with image from Witzel et al., 2012
cardiac ventricle cardiac muscle cell increased amount, abnormal s883Tg + MO1-ajuba standard conditions Fig. 3 with image from Witzel et al., 2012
pericardium edematous, abnormal s883Tg + MO1-ajuba standard conditions Fig. 3 with image from Witzel et al., 2012
heart increased size, abnormal s883Tg + MO1-ajuba standard conditions Fig. 3 with image from Witzel et al., 2012
atrium cardiac muscle cell ab2-isl labeling increased distribution, abnormal s883Tg + MO1-ajuba standard conditions Fig. 4 with image from Witzel et al., 2012
heart rudiment peripheral region ab2-isl labeling increased distribution, abnormal s883Tg + MO1-ajuba standard conditions Fig. 4 with image from Witzel et al., 2012
heart tube ab2-isl labeling increased distribution, abnormal s883Tg + MO1-ajuba standard conditions Fig. 4 with image from Witzel et al., 2012
determination of heart left/right asymmetry disrupted, abnormal s883Tg + MO1-ajuba standard conditions Fig. 3 with image from Witzel et al., 2012
heart tube peripheral region ab2-isl labeling increased distribution, abnormal s883Tg + MO1-ajuba standard conditions Fig. 4 with image from Witzel et al., 2012
heart contraction decreased rate, abnormal s883Tg + MO1-ajuba standard conditions text only from Witzel et al., 2012
cardiac muscle cell increased amount, abnormal s883Tg + MO1-ajuba standard conditions Fig. 4 with image from Witzel et al., 2012
heart rudiment ab2-isl labeling increased distribution, abnormal s883Tg + MO1-ajuba standard conditions Fig. 4 with image from Witzel et al., 2012
heart isl1a expression increased distribution, abnormal s883Tg + MO1-ajuba standard conditions Fig. 4 with image from Witzel et al., 2012
heart contraction decreased rate, abnormal f2Tg; s883Tg + MO1-ajuba standard conditions text only from Witzel et al., 2012
atrium cardiac muscle cell increased amount, abnormal f2Tg; s883Tg + MO1-ajuba standard conditions Fig. 3 with image from Witzel et al., 2012
heart increased size, abnormal f2Tg; s883Tg + MO1-ajuba standard conditions Fig. 3 with image from Witzel et al., 2012
atrium orientation cardiac ventricle, abnormal f2Tg; s883Tg + MO1-ajuba standard conditions Fig. 3 with image from Witzel et al., 2012
primitive heart tube GFP expression increased distribution, abnormal ncv11Tg; ncv47Tg + MO1-ajuba control Fig. 2 with image from Fukui et al., 2018
cardiac muscle cell increased amount, abnormal s883Tg + MO1-ajuba + MO4-isl1a standard conditions Fig. 4 with image from Witzel et al., 2012
cardiac muscle cell mislocalised, abnormal s883Tg + MO1-ajuba + MO4-isl1a standard conditions Fig. 4 with image from Witzel et al., 2012
heart isl1a expression increased distribution, abnormal s883Tg + MO1-ajuba + MO4-isl1a standard conditions Fig. 4 with image from Witzel et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.