header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120813-1
Morpholino Name: MO3-socs3a
Target: socs3a (1)
Sequence:
5' - CCCTGAGCTGCCGGGAAGCAGATCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the 5'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-socs3a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-socs3a
Expressed Gene Anatomy Figures
atoh1a Fig. 3 from Liang et al., 2012
PHENOTYPE
Phenotype resulting from MO3-socs3a
Phenotype of all Fish created by or utilizing MO3-socs3a
OTHER MO3-socs3a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)