ZFIN ID: ZDB-MRPHLNO-120710-2
Morpholino Name: MO3-cdc73
Target: cdc73 (1)
Sequence:
5' - TTACTTACTGCAGCTCTCCGCACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-cdc73 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-cdc73
Expressed Gene Anatomy Figures
plp1a Fig. 1 from Kim et al., 2012
sox10 Fig. 1 from Kim et al., 2012
PHENOTYPE
Phenotype resulting from MO3-cdc73
Phenotype of all Fish created by or utilizing MO3-cdc73
Genome Resources:
CITATIONS (1)