Morpholino
MO5-sema3d
- ID
- ZDB-MRPHLNO-120627-1
- Name
- MO5-sema3d
- Previous Names
- None
- Target
- Sequence
-
5' - TGTCCGGCTCCCCTGCAGTCTTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-sema3d
No data available
Phenotype
Phenotype resulting from MO5-sema3d
No data available
Phenotype of all Fish created by or utilizing MO5-sema3d
1 - 5 of 8 Show all
Citations
- Bhattacharya, S., Hyland, C., Falk, M.M., Iovine, M.K. (2020) Connexin43 gap junctional intercellular communication inhibits evx1 expression and joint formation in regenerating fins. Development (Cambridge, England). 147(13):
- Govindan, J., Tun, K.M., Iovine, M.K. (2016) Cx43-Dependent Skeletal Phenotypes Are Mediated by Interactions between the Hapln1a-ECM and Sema3d during Fin Regeneration. PLoS One. 11:e0148202
- Bhadra, J., Iovine, M.K. (2015) Hsp47 mediates Cx43-dependent skeletal growth and patterning in the regenerating fin. Mechanisms of Development. 138 Pt 3:364-74
- Govindan, J., and Iovine, M.K. (2014) Hapln1a is required for connexin43-dependent growth and patterning in the regenerating fin skeleton. PLoS One. 9(2):e88574
- Ton, Q.V., and Iovine, M.K. (2012) Semaphorin3d mediates Cx43-dependent phenotypes during fin regeneration. Developmental Biology. 366(2):195-203
1 - 5 of 5
Show