ZFIN ID: ZDB-MRPHLNO-120605-6
Morpholino Name: MO1-elavl3
Target: elavl3 (1)
Previous Name: elavl3TP (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCTTTGGCTAACACAGCGTTATTTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This morpholino acts as a target protector by inhibiting the binding of miR-9 to the target sequence in the 3'UTR of elavl3.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-elavl3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-elavl3
Expressed Gene Anatomy Figures
elavl3 Fig. 5 with image from Coolen et al., 2012
PHENOTYPE
Phenotype resulting from MO1-elavl3
Phenotype Figures
hindbrain cell proliferation in hindbrain ventricular zone decreased occurrence, abnormal Fig. 5 with image from Coolen et al., 2012
hindbrain neurogenesis premature, abnormal Fig. 5 with image from Coolen et al., 2012

Phenotype of all Fish created by or utilizing MO1-elavl3
Phenotype Fish Conditions Figures
hindbrain neurogenesis premature, abnormal WT + MO1-elavl3 standard conditions Fig. 5 with image from Coolen et al., 2012
hindbrain cell proliferation in hindbrain ventricular zone decreased occurrence, abnormal WT + MO1-elavl3 standard conditions Fig. 5 with image from Coolen et al., 2012
OTHER MO1-elavl3 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)