Morpholino
MO1-f2r
- ID
- ZDB-MRPHLNO-120604-3
- Name
- MO1-f2r
- Previous Names
- None
- Target
- Sequence
-
5' - CCGTCACCAACAGAACCCGCAACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-f2r
No data available
Phenotype
Phenotype resulting from MO1-f2r
1 - 5 of 24 Show all
Phenotype of all Fish created by or utilizing MO1-f2r
1 - 5 of 25 Show all
Citations
- Lei, D., Zhang, X., Rouf, M.A., Mahendra, Y., Wen, L., Li, Y., Zhang, X., Li, L., Wang, L., Zhang, T., Wang, G., Wang, Y. (2021) Noncanonical protease-activated receptor 1 regulates lymphatic differentiation in zebrafish. iScience. 24:103386
- Ellertsdottir, E., Berthold, P.R, Bouzaffour, M., Dufourcq, P., Trayer, V., Gauron, C., Vriz, S., Affolter, M., and Rampon, C. (2012) Developmental Role of Zebrafish Protease-Activated Receptor 1 (PAR1) in the Cardio-Vascular System. PLoS One. 7(7):e42131
- Yue, R., Li, H., Liu, H., Li, Y., Wei, B., Gao, G., Jin, Y., Liu, T., Wei, L., Du, J., and Pei, G. (2012) Thrombin Receptor Regulates Hematopoiesis and Endothelial-to-Hematopoietic Transition. Developmental Cell. 22(5):1092-1100
1 - 3 of 3
Show