Morpholino

MO1-f2r

ID
ZDB-MRPHLNO-120604-3
Name
MO1-f2r
Previous Names
None
Target
Sequence
5' - CCGTCACCAACAGAACCCGCAACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-f2r
No data available
Phenotype
Phenotype resulting from MO1-f2r
Phenotype Fish Figures
blood increased accumulation caudal vein, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
blood increased accumulation vasculature, abnormal AB + MO1-f2r Fig. 1 with image from Ellertsdottir et al., 2012
blood increased accumulation blood island, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
blood increased accumulation post-vent region, abnormal AB + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
blood circulation disrupted, abnormal AB + MO1-f2r Fig. 1 with image from Ellertsdottir et al., 2012
caudal vein dilated, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 3 with image,  Fig. 4 with image from Ellertsdottir et al., 2012
caudal vein disorganized, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 4 with image from Ellertsdottir et al., 2012
caudal vein functionality, abnormal AB + MO1-f2r Fig. 1 with image from Ellertsdottir et al., 2012
caudal vein malformed, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
central artery hemorrhagic, abnormal s843Tg; sd2Tg + MO1-f2r text only from Ellertsdottir et al., 2012
circulatory system development disrupted, abnormal AB + MO1-f2r Fig. 1 with image from Ellertsdottir et al., 2012
dorsal aorta decreased size, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 4 with image,  text only from Ellertsdottir et al., 2012
endothelial to hematopoietic transition increased occurrence, abnormal WT + MO1-f2r Fig. 4 with image from Yue et al., 2012
heart edematous, abnormal AB + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
heart contraction decreased rate, abnormal AB + MO1-f2r Fig. 1 with image,  Fig. 2 with image from Ellertsdottir et al., 2012
hematopoietic stem cell differentiation increased occurrence, abnormal WT + MO1-f2r Fig. 4 with image from Yue et al., 2012
intersegmental vessel collapsed, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 4 with image from Ellertsdottir et al., 2012
midbrain hemorrhagic, abnormal s843Tg; sd2Tg + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
mouth structure, abnormal AB + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
optic choroid vascular plexus hemorrhagic, abnormal s843Tg; sd2Tg + MO1-f2r text only from Ellertsdottir et al., 2012
post-vent region bent, abnormal AB + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
posterior cardinal vein functionality, abnormal AB + MO1-f2r Fig. 1 with image from Ellertsdottir et al., 2012
swim bladder physical object quality, abnormal AB + MO1-f2r Fig. 3 with image from Ellertsdottir et al., 2012
ventral wall of dorsal aorta hematopoietic stem cell increased amount, abnormal WT + MO1-f2r Fig. 4 with image from Yue et al., 2012
Phenotype of all Fish created by or utilizing MO1-f2r
Phenotype Fish Conditions Figures
mouth structure, abnormal AB + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
caudal vein functionality, abnormal AB + MO1-f2r standard conditions Fig. 1 with image from Ellertsdottir et al., 2012
heart edematous, abnormal AB + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
blood circulation disrupted, abnormal AB + MO1-f2r standard conditions Fig. 1 with image from Ellertsdottir et al., 2012
circulatory system development disrupted, abnormal AB + MO1-f2r standard conditions Fig. 1 with image from Ellertsdottir et al., 2012
blood increased accumulation vasculature, abnormal AB + MO1-f2r standard conditions Fig. 1 with image from Ellertsdottir et al., 2012
posterior cardinal vein functionality, abnormal AB + MO1-f2r standard conditions Fig. 1 with image from Ellertsdottir et al., 2012
blood increased accumulation post-vent region, abnormal AB + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
post-vent region bent, abnormal AB + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
blood increased accumulation blood island, abnormal AB + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
heart contraction decreased rate, abnormal AB + MO1-f2r standard conditions Fig. 1 with image,  Fig. 2 with image from Ellertsdottir et al., 2012
swim bladder physical object quality, abnormal AB + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
ventral wall of dorsal aorta hematopoietic stem cell increased amount, abnormal WT + MO1-f2r standard conditions Fig. 4 with image from Yue et al., 2012
hematopoietic stem cell differentiation increased occurrence, abnormal WT + MO1-f2r standard conditions Fig. 4 with image from Yue et al., 2012
endothelial to hematopoietic transition increased occurrence, abnormal WT + MO1-f2r standard conditions Fig. 4 with image from Yue et al., 2012
optic choroid vascular plexus hemorrhagic, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions text only from Ellertsdottir et al., 2012
blood increased accumulation caudal vein, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
caudal vein malformed, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
blood increased accumulation blood island, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
caudal vein disorganized, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
central artery hemorrhagic, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions text only from Ellertsdottir et al., 2012
intersegmental vessel collapsed, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 4 with image from Ellertsdottir et al., 2012
dorsal aorta decreased size, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 4 with image,  text only from Ellertsdottir et al., 2012
midbrain hemorrhagic, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 3 with image from Ellertsdottir et al., 2012
caudal vein dilated, abnormal s843Tg; sd2Tg + MO1-f2r standard conditions Fig. 3 with image,  Fig. 4 with image from Ellertsdottir et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.