Morpholino
MO1-nek8
- ID
- ZDB-MRPHLNO-120521-1
- Name
- MO1-nek8
- Previous Names
- None
- Target
- Sequence
-
5' - CTTCTCATACTTCTCCATGTTTTCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nek8
No data available
Phenotype
Phenotype resulting from MO1-nek8
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-nek8
1 - 5 of 8 Show all
Citations
- Hoff, S., Halbritter, J., Epting, D., Frank, V., Nguyen, T.M., van Reeuwijk, J., Boehlke, C., Schell, C., Yasunaga, T., Helmstädter, M., Mergen, M., Filhol, E., Boldt, K., Horn, N., Ueffing, M., Otto, E.A., Eisenberger, T., Elting, M.W., van Wijk, J.A., Bockenhauer, D., Sebire, N.J., Rittig, S., Vyberg, M., Ring, T., Pohl, M., Pape, L., Neuhaus, T.J., Elshakhs, N.A., Koon, S.J., Harris, P.C., Grahammer, F., Huber, T.B., Kuehn, E.W., Kramer-Zucker, A., Bolz, H.J., Roepman, R., Saunier, S., Walz, G., Hildebrandt, F., Bergmann, C., and Lienkamp, S.S. (2013) ANKS6 is a central component of a nephronophthisis module linking NEK8 to INVS and NPHP3. Nature Genetics. 45(8):951-6
- Manning, D.K., Sergeev, M., van Heesbeen, R.G., Wong, M.D., Oh, J.H., Liu, Y., Henkelman, R.M., Drummond, I., Shah, J.V., and Beier, D.R. (2013) Loss of the ciliary kinase nek8 causes left-right asymmetry defects. Journal of the American Society of Nephrology : JASN. 34(1):100-112
- Liu, S., Lu, W., Obara, T., Kuida, S., Lehoczky, J., Dewar, K., Drummond, I.A., and Beier, D.R. (2002) A defect in a novel Nek-family kinase causes cystic kidney disease in the mouse and in zebrafish. Development (Cambridge, England). 129(24):5839-5846
1 - 3 of 3
Show