Morpholino

MO1-arf6a,arf6b

ID

ZDB-MRPHLNO-120425-4

Name

MO1-arf6a,arf6b

Previous Names

MO1-arf6
MO1-arf6a
MOArf6-a (1)

Targets

arf6a (1)
arf6b (1)

Sequence

5' - GATCTTGGAAAGCATCTTCCCCATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-arf6a,arf6b

No data available

Phenotype

Phenotype resulting from MO1-arf6a,arf6b

No data available

Phenotype of all Fish created by or utilizing MO1-arf6a,arf6b

Phenotype	Fish	Conditions	Figures
spinal cord apoptotic process increased process quality, abnormal	tamalin^km12/km12 + MO1-arf6a,arf6b (AB)	control	Figure 6 , Figure 7 from Seo et al., 2022
spinal cord apoptotic process process quality, ameliorated	tamalin^km12/km12 + MO1-arf6a,arf6b (AB)	chemical treatment by environment: 2-methyl-6-(phenylethynyl)pyridine	Figure 7 from Seo et al., 2022
spinal cord neuron apoptotic, abnormal	tamalin^km12/km12 + MO1-arf6a,arf6b (AB)	control	Figure 7 from Seo et al., 2022
neuron apoptotic process increased process quality, abnormal	tamalin^km12/km12 + MO1-arf6a,arf6b (AB)	control	Figure 6 from Seo et al., 2022
oligodendrocyte apoptotic process increased process quality, abnormal	tamalin^km12/km12 + MO1-arf6a,arf6b (AB)	control	Figure 6 from Seo et al., 2022
gall bladder phospholipid decreased amount, abnormal	WT + MO1-arf6a,arf6b + MO1-man1a2	control	FIGURE 4 from So et al., 2020
intestinal bulb decreased size, abnormal	s870Tg + MO1-arf6a,arf6b	standard conditions	Fig. S8 from Ningappa et al., 2015
swim bladder absent, abnormal	s870Tg + MO1-arf6a,arf6b	standard conditions	Fig. S8 from Ningappa et al., 2015
pancreas decreased size, abnormal	s870Tg + MO1-arf6a,arf6b	standard conditions	Fig. S8 from Ningappa et al., 2015
cholangiocyte aggregated, abnormal	s939Tg + MO1-arf6a,arf6b	standard conditions	Fig. 3 from Ningappa et al., 2015
bile ductule decreased length, abnormal	um14Tg + MO1-arf6a,arf6b	standard conditions	Fig. 3 from Ningappa et al., 2015
bile canaliculus decreased length, abnormal	um14Tg + MO1-arf6a,arf6b	standard conditions	Fig. 3 from Ningappa et al., 2015
cholangiocyte filopodium decreased length, abnormal	um14Tg + MO1-arf6a,arf6b	standard conditions	Fig. 3 from Ningappa et al., 2015
cholangiocyte decreased amount, abnormal	um14Tg + MO1-arf6a,arf6b	standard conditions	Fig. 3 from Ningappa et al., 2015
intrahepatic bile duct disconnected, abnormal	s939Tg + MO1-arf6a,arf6b + MO1-man1a2	control	FIGURE 4 from So et al., 2020
hepatocyte decreased functionality, abnormal	gz15Tg; um14Tg + MO1-arf6a,arf6b	chemical treatment: tyrphostin AG 1478	Fig. 5 from Ningappa et al., 2015
liver decreased size, abnormal	gz15Tg; um14Tg + MO1-arf6a,arf6b	standard conditions	Fig. 2 from Ningappa et al., 2015
hepatocyte decreased functionality, abnormal	gz15Tg; um14Tg + MO1-arf6a,arf6b	standard conditions	Fig. 2 from Ningappa et al., 2015
intrahepatic bile duct decreased amount, abnormal	gz15Tg; um14Tg + MO1-arf6a,arf6b	standard conditions	Fig. 2 from Ningappa et al., 2015
intrahepatic bile duct development disrupted, abnormal	gz15Tg; um14Tg + MO1-arf6a,arf6b	chemical treatment: tyrphostin AG 1478	Fig. 5 from Ningappa et al., 2015
intrahepatic bile duct epithelial cell filopodium decreased mobility, abnormal	s939Tg; um14Tg + MO1-arf6a,arf6b	standard conditions	Fig. S6 from Ningappa et al., 2015
spinal cord oligodendrocyte decreased amount, abnormal	tamalin^km12/km12; ck1Tg + MO1-arf6a,arf6b (AB)	control	Figure 6 from Seo et al., 2022
spinal cord neuron grm5b expression increased amount, abnormal	tamalin^km12/km12; km13Tg; nkuasgfp1aTg + MO1-arf6a,arf6b (AB)	control	Figure 7 from Seo et al., 2022
spinal cord neuron grm5a expression increased amount, abnormal	tamalin^km12/km12; km13Tg; nkuasgfp1aTg + MO1-arf6a,arf6b (AB)	control	Figure 7 from Seo et al., 2022

Citations