ZFIN ID: ZDB-MRPHLNO-120425-10
Morpholino Name: MO2-mir9
Targets: mir9-1 (1), mir9-2 (1), mir9-3 (1), mir9-4 (1), mir9-5 (1), mir9-6 (1), mir9-7 (1)
Sequence:
5' - ACTCATACAGCTAGATAACCAAAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 7 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-mir9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-mir9 No data available
PHENOTYPE
Phenotype resulting from MO2-mir9
No data available

Phenotype of all Fish created by or utilizing MO2-mir9
Genome Resources:
CITATIONS (2)