Morpholino

MO1-gle1

ID
ZDB-MRPHLNO-120406-2
Name
MO1-gle1
Previous Names
  • drgle1ATG1 (1)
Target
Sequence
5' - TCAGAAGGCATTTTGAGGGCATTAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gle1
No data available
Phenotype
Phenotype resulting from MO1-gle1
No data available
Phenotype of all Fish created by or utilizing MO1-gle1
Phenotype Fish Conditions Figures
trunk curved dorsal, abnormal AB + MO1-gle1 + MO2-gle1 standard conditions Fig. 3 from Wolf et al., 2020
eye decreased size, abnormal AB + MO1-gle1 + MO2-gle1 standard conditions Fig. 3 from Wolf et al., 2020
head decreased size, abnormal AB + MO1-gle1 + MO2-gle1 standard conditions Fig. 3 from Wolf et al., 2020
Kupffer's vesicle cilium movement decreased rate, abnormal AB + MO1-gle1 + MO2-gle1 control Fig. 4 with image from Jao et al., 2017
retina morphology, abnormal AB + MO1-gle1 + MO2-gle1 standard conditions Fig. S2,  Fig. S3 from Wolf et al., 2020
retina apoptotic process increased occurrence, abnormal AB + MO1-gle1 + MO2-gle1 standard conditions Fig. S2 from Wolf et al., 2020
neuronal stem cell population maintenance decreased process quality, abnormal WT + MO1-gle1 + MO2-gle1 standard conditions Fig. 6 with image from Jao et al., 2012
spinal cord neuronal stem cell apoptotic, abnormal WT + MO1-gle1 + MO2-gle1 standard conditions Fig. 6 with image from Jao et al., 2012
head cell necrotic, abnormal WT + MO1-gle1 + MO2-gle1 standard conditions Fig. 5,  Fig. S2 from Kaneb et al., 2015
spinal cord lacks parts or has fewer parts of type secondary motor neuron, abnormal ml2Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 5 with image from Jao et al., 2012
heart tube position, abnormal vu504Tg + MO1-gle1 + MO2-gle1 control Fig. 4 with image from Jao et al., 2017
heart looping disrupted, abnormal vu504Tg + MO1-gle1 + MO2-gle1 control Fig. 4 with image from Jao et al., 2017
determination of heart left/right asymmetry disrupted, abnormal vu504Tg + MO1-gle1 + MO2-gle1 control Fig. 4 with image from Jao et al., 2017
axon extension decreased process quality, abnormal vu504Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 4 with image from Jao et al., 2012
motor neuron morphology, abnormal vu504Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 5 from Kaneb et al., 2015
motor neuron branchiness, abnormal vu504Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 5 from Kaneb et al., 2015
motor neuron axon disorganized, abnormal vu504Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 4 with image from Jao et al., 2012
spinal cord neuronal stem cell apoptotic, abnormal mi2001Tg; vu504Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 6 with image from Jao et al., 2012
neuronal stem cell population maintenance decreased process quality, abnormal mi2001Tg; vu504Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 6 with image from Jao et al., 2012
retina morphology, ameliorated mkrn2uot12/uot12 + MO1-gle1 + MO2-gle1 standard conditions Fig. S3 from Wolf et al., 2020
retina cell differentiation process quality, ameliorated mkrn2uot12/uot12 + MO1-gle1 + MO2-gle1 standard conditions Fig. 4 from Wolf et al., 2020
retina area, ameliorated mkrn2uot12/uot12 + MO1-gle1 + MO2-gle1 standard conditions Fig. S3 from Wolf et al., 2020
retina decreased size, abnormal AB + MO1-gle1 + MO1-mkrn2 + MO2-gle1 standard conditions Fig. S2 from Wolf et al., 2020
head decreased size, abnormal AB + MO1-gle1 + MO1-mkrn2 + MO2-gle1 standard conditions Fig. 3 from Wolf et al., 2020
eye decreased size, abnormal AB + MO1-gle1 + MO1-mkrn2 + MO2-gle1 standard conditions Fig. 3 from Wolf et al., 2020
trunk curved ventral, abnormal AB + MO1-gle1 + MO1-mkrn2 + MO2-gle1 standard conditions Fig. 3 from Wolf et al., 2020
retina apoptotic process process quality, ameliorated AB + MO1-gle1 + MO1-mkrn2 + MO2-gle1 standard conditions Fig. 4 from Wolf et al., 2020
retina morphology, ameliorated AB + MO1-gle1 + MO1-mkrn2 + MO2-gle1 standard conditions Fig. 4 from Wolf et al., 2020
heart looping disrupted, abnormal vu504Tg + MO1-gle1 + MO1-ippk + MO2-gle1 standard conditions Fig. 4 with image from Jao et al., 2017
heart tube position, abnormal vu504Tg + MO1-gle1 + MO1-ippk + MO2-gle1 standard conditions Fig. 4 with image from Jao et al., 2017
determination of heart left/right asymmetry disrupted, abnormal vu504Tg + MO1-gle1 + MO1-ippk + MO2-gle1 standard conditions Fig. 4 with image from Jao et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.