Morpholino

MO2-wnt16

ID
ZDB-MRPHLNO-120329-2
Name
MO2-wnt16
Previous Names
  • W16MO2 (1)
Target
Sequence
5' - GCGTGGAATACTTACATCCAACTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt16
No data available
Phenotype
Phenotype resulting from MO2-wnt16
Phenotype of all Fish created by or utilizing MO2-wnt16
Phenotype Fish Conditions Figures
somite etv4 expression decreased amount, abnormal AB + MO2-wnt16 standard conditions Fig. 4 from Lee et al., 2014
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO2-wnt16 standard conditions Fig. 4 from Lee et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO2-wnt16 standard conditions Fig. 7 from Kim et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal AB + MO2-wnt16 standard conditions Fig. 4 from Lee et al., 2014
somite fgfr4 expression decreased amount, abnormal AB + MO2-wnt16 standard conditions Fig. 4 from Lee et al., 2014
hematopoietic stem cell differentiation disrupted, abnormal WT + MO1-wnt16 + MO2-wnt16 standard conditions Fig. 1Fig. 3 from Clements et al., 2011
trunk altered number of intersegmental vessel, abnormal WT + MO1-wnt16 + MO2-wnt16 standard conditions Fig. 2 from Clements et al., 2011
intersegmental vessel spatial pattern, abnormal WT + MO1-wnt16 + MO2-wnt16 standard conditions Fig. 2 from Clements et al., 2011
Notch signaling pathway disrupted, abnormal WT + MO1-wnt16 + MO2-wnt16 standard conditions Fig. 3 from Clements et al., 2011
hematopoietic stem cell absent, abnormal WT + MO1-wnt16 + MO2-wnt16 standard conditions Fig. 1 from Clements et al., 2011
thymus T cell absent, abnormal WT + MO1-wnt16 + MO2-wnt16 standard conditions Fig. 1 from Clements et al., 2011
dorsal aorta hematopoietic stem cell runx1 expression absent, abnormal WT + MO2-wnt16 standard conditions Fig. S2 with image from Genthe et al., 2017
somite wnt16 expression decreased amount, abnormal WT + MO2-wnt16 standard conditions Fig. S2 with image from Genthe et al., 2017
dorsal aorta hematopoietic stem cell absent, abnormal WT + MO2-wnt16 standard conditions Fig. S2 with image from Genthe et al., 2017
ventral wall of dorsal aorta runx1 expression amount, ameliorated pd3Tg + MO2-wnt16 heat shock Fig. 4 from Lee et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal pd3Tg + MO2-wnt16 heat shock Fig. 4 from Lee et al., 2014
Citations