Morpholino

MO2-wif1

ID
ZDB-MRPHLNO-120319-4
Name
MO2-wif1
Previous Names
  • i1e2-MO (1)
Target
Sequence
5' - AAACCTGTTCAATAAAACACTGCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wif1
No data available
Phenotype
Phenotype resulting from MO2-wif1
Phenotype of all Fish created by or utilizing MO2-wif1
Phenotype Fish Conditions Figures
swim bladder decreased size, abnormal WT + MO2-wif1 standard conditions Fig. 5 from Yin et al., 2012
smooth muscle tissue development disrupted, abnormal WT + MO2-wif1 standard conditions Fig. 4 from Yin et al., 2012
swim bladder development disrupted, abnormal WT + MO2-wif1 standard conditions Fig. 4Fig. 5 from Yin et al., 2012
canonical Wnt signaling pathway increased occurrence, abnormal WT + MO2-wif1 standard conditions Fig. 2 from Yin et al., 2012
swim bladder mesenchyme decreased size, abnormal WT + MO2-wif1 standard conditions Fig. 4 from Yin et al., 2012
swim bladder epithelium decreased size, abnormal WT + MO2-wif1 standard conditions Fig. 4 from Yin et al., 2012
visceral peritoneum disorganized, abnormal WT + MO2-wif1 standard conditions Fig. 4 from Yin et al., 2012
pancreas morphology, abnormal WT + MO2-wif1 standard conditions Fig. 4 from Yin et al., 2012
tunica interna swim bladder smooth muscle absent, abnormal WT + MO2-wif1 standard conditions Fig. 4 from Yin et al., 2012
interpeduncular nucleus tegmentum innervation process quality, abnormal hd1Tg + MO1-wif1 + MO2-wif1 standard conditions Fig. 4 with image from Guglielmi et al., 2020
habenula neuron decreased amount, abnormal hd1Tg + MO1-wif1 + MO2-wif1 standard conditions Fig. 4 with image from Guglielmi et al., 2020
swim bladder development disrupted, abnormal sqET33-2Et + MO2-wif1 standard conditions Fig. 3 from Yin et al., 2012
anterior swim bladder bud absent, abnormal sqET33-2Et + MO2-wif1 standard conditions Fig. 3 from Yin et al., 2012
somite immature, abnormal sqET33-2Et + MO2-wif1 standard conditions Fig. 3 from Yin et al., 2012
trunk decreased length, abnormal sqET33-2Et + MO2-wif1 standard conditions Fig. 3 from Yin et al., 2012
swim bladder decreased size, abnormal sqET33-2Et + MO2-wif1 standard conditions Fig. 3 from Yin et al., 2012
anterior swim bladder bud decreased size, abnormal sqET33-2Et + MO2-wif1 standard conditions Fig. 3 from Yin et al., 2012
somite immature, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
swim bladder decreased size, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
anterior swim bladder bud absent, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
anterior swim bladder bud decreased size, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
swim bladder development disrupted, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
trunk decreased length, abnormal sqET33-2Et + MO2-wif1 + MO4-tp53 standard conditions Fig. 3 from Yin et al., 2012
Citations