Morpholino
MO5-nr3c1
- ID
- ZDB-MRPHLNO-120313-2
- Name
- MO5-nr3c1
- Previous Names
- None
- Target
- Sequence
-
5' - CTCCAGTCCTCCTTGATCCATTTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-nr3c1
No data available
Phenotype
Phenotype resulting from MO5-nr3c1
Phenotype | Fish | Figures |
---|---|---|
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal | WT + MO5-nr3c1 |
Fig. 6,
Fig. 7
from Kwan et al., 2016 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO5-nr3c1
1 - 5 of 8 Show all
Citations
- Kwan, W., Cortes, M., Frost, I., Esain, V., Theodore, L.N., Liu, S.Y., Budrow, N., Goessling, W., North, T.E. (2016) The Central Nervous System Regulates Embryonic HSPC Production via Stress-Responsive Glucocorticoid Receptor Signaling. Cell Stem Cell. 19:370-82
- Kumai, Y., Bernier, N.J., and Perry, S.F. (2014) Angiotensin II promotes Na+ uptake in larval zebrafish, Danio rerio, in acidic and ion-poor water. The Journal of endocrinology. 220(3):195-205
- Kwong, R.W., and Perry, S.F. (2013) Cortisol regulates epithelial permeability and sodium losses in zebrafish exposed to acidic water. The Journal of endocrinology. 217:253-264
- Nesan, D., and Vijayan, M.M. (2013) The transcriptomics of glucocorticoid receptor signaling in developing zebrafish. PLoS One. 8(11):e80726
- Kumai, Y., Nesan, D., Vijayan, M.M., and Perry, S.F. (2012) Cortisol regulates Na(+) uptake in zebrafish, Danio rerio, larvae via the glucocorticoid receptor. Molecular and Cellular Endocrinology. 364(1-2):113-125
- Nesan, D., Kamkar, M., Burrows, J., Scott, I.C., Marsden, M., Vijayan, M.M. (2012) Glucocorticoid Receptor Signaling Is Essential for Mesoderm Formation and Muscle Development in Zebrafish. Endocrinology. 153(3):1288-1300
1 - 6 of 6
Show