Morpholino

MO5-nr3c1

ID
ZDB-MRPHLNO-120313-2
Name
MO5-nr3c1
Previous Names
None
Target
Sequence
5' - CTCCAGTCCTCCTTGATCCATTTTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-nr3c1
Phenotype
Phenotype resulting from MO5-nr3c1
Phenotype of all Fish created by or utilizing MO5-nr3c1
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal WT + MO5-nr3c1 chemical treatment by environment: cortisol Fig. 6 from Kwan et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal WT + MO5-nr3c1 chemical treatment by environment: serotonin Fig. 6 from Kwan et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal WT + MO5-nr3c1 control Fig. 6Fig. 7 from Kwan et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal WT + MO5-nr3c1 chemical treatment by environment: cobalt dichloride Fig. 7 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal pd27Tg; zf169Tg + MO5-nr3c1 control Fig. 6Fig. 7 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal pd27Tg; zf169Tg + MO5-nr3c1 chemical treatment by environment: serotonin Fig. 6 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal pd27Tg; zf169Tg + MO5-nr3c1 chemical treatment by environment: cobalt dichloride Fig. 7 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal pd27Tg; zf169Tg + MO5-nr3c1 chemical treatment by environment: cortisol Fig. 6 from Kwan et al., 2016
Citations