ZFIN ID: ZDB-MRPHLNO-120213-2
Morpholino Name: MO4-csf3r
Target: csf3r (1)
Sequence:
5' - ATTCAAGCACATACTCACTTCCATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-csf3r No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-csf3r No data available
PHENOTYPE
Phenotype resulting from MO4-csf3r
Phenotype of all Fish created by or utilizing MO4-csf3r
Genome Resources:
CITATIONS (3)