Morpholino

MO4-pitx2

ID
ZDB-MRPHLNO-120210-3
Name
MO4-pitx2
Previous Names
  • pitx2ex4/5 (1)
Target
Sequence
5' - TTTATCAAACTTACTCGGACTCTGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-pitx2
Expressed Gene Anatomy Figures
dkk1a Fig. 5 with image from Liu et al., 2012
dlx2a Fig. 4 with image from Liu et al., 2012
dlx4a Fig. 4 with image from Liu et al., 2012
foxd3 Fig. 4 with image from Liu et al., 2012
pax6a Fig. 5 with image from Liu et al., 2012
pitx2 Fig. 1 with image,  Fig. 3 with image from Liu et al., 2012
pitx3 Fig. 5 with image from Liu et al., 2012
Phenotype
Phenotype resulting from MO4-pitx2
Phenotype Fish Figures
anterior segment eye increased accumulation cell, abnormal WT + MO4-pitx2 Fig. 2 with image,  Fig. 3 with image from Liu et al., 2012
anterior segment eye structure, abnormal WT + MO4-pitx2 Fig. 2 with image,  Fig. 5 with image from Liu et al., 2012
anterior segment eye cell disorganized, abnormal WT + MO4-pitx2 Fig. 3 with image from Liu et al., 2012
basibranchial hypoplastic, abnormal WT + MO4-pitx2 Fig. 2 with image from Liu et al., 2012
basihyal cartilage hypoplastic, abnormal WT + MO4-pitx2 Fig. 2 with image from Liu et al., 2012
camera-type eye morphogenesis process quality, abnormal WT + MO4-pitx2 Fig. 5 with image from Liu et al., 2012
ceratobranchial cartilage hypoplastic, abnormal WT + MO4-pitx2 Fig. 2 with image from Liu et al., 2012
ceratohyal cartilage position, abnormal WT + MO4-pitx2 Fig. 2 with image from Liu et al., 2012
cornea morphology, abnormal WT + MO4-pitx2 Fig. 5 with image from Liu et al., 2012
eye decreased size, abnormal WT + MO4-pitx2 Fig. 1 with image,  Fig. 2 with image from Liu et al., 2012
eye shape, abnormal WT + MO4-pitx2 Fig. 2 with image from Liu et al., 2012
head decreased size, abnormal WT + MO4-pitx2 Fig. 1 with image from Liu et al., 2012
head malformed, abnormal WT + MO4-pitx2 Fig. 1 with image from Liu et al., 2012
hyaloid vessel disorganized, abnormal y1Tg + MO4-pitx2 Fig. 5 with image from Liu et al., 2012
hyaloid vessel morphology, abnormal WT + MO4-pitx2 Fig. 3 with image from Liu et al., 2012
iris morphology, abnormal WT + MO4-pitx2 Fig. 5 with image from Liu et al., 2012
lens decreased size, abnormal WT + MO4-pitx2 Fig. 5 with image from Liu et al., 2012
mandibular arch skeleton morphology, abnormal WT + MO4-pitx2 Fig. 1 with image from Liu et al., 2012
Meckel's cartilage hypoplastic, abnormal WT + MO4-pitx2 Fig. 2 with image from Liu et al., 2012
Meckel's cartilage position, abnormal WT + MO4-pitx2 Fig. 2 with image from Liu et al., 2012
Meckel's cartilage shape, abnormal WT + MO4-pitx2 Fig. 2 with image from Liu et al., 2012
mouth open, abnormal WT + MO4-pitx2 Fig. 2 with image from Liu et al., 2012
ocular blood vessel has extra parts of type hyaloid vessel, abnormal y1Tg + MO4-pitx2 Fig. 5 with image from Liu et al., 2012
oral cavity malformed, abnormal WT + MO4-pitx2 Fig. 3 with image,  Fig. 5 with image from Liu et al., 2012
palatoquadrate cartilage hypoplastic, abnormal WT + MO4-pitx2 Fig. 2 with image from Liu et al., 2012
palatoquadrate cartilage shape, abnormal WT + MO4-pitx2 Fig. 2 with image from Liu et al., 2012
pericardium edematous, abnormal WT + MO4-pitx2 Fig. 1 with image from Liu et al., 2012
pharyngeal arch malformed, abnormal WT + MO4-pitx2 Fig. 3 with image,  Fig. 5 with image from Liu et al., 2012
pharyngeal arch 2 skeleton mislocalised ventrally, abnormal WT + MO4-pitx2 Fig. 2 with image from Liu et al., 2012
retina shape, abnormal WT + MO4-pitx2 Fig. 5 with image from Liu et al., 2012
trunk decreased length, abnormal WT + MO4-pitx2 Fig. 1 with image from Liu et al., 2012
trunk kinked, abnormal WT + MO4-pitx2 Fig. 1 with image from Liu et al., 2012
ventral mandibular arch mislocalised ventrally, abnormal WT + MO4-pitx2 Fig. 2 with image from Liu et al., 2012
whole organism viability, abnormal WT + MO4-pitx2 Fig. 1 with image from Liu et al., 2012
Phenotype of all Fish created by or utilizing MO4-pitx2
Phenotype Fish Conditions Figures
head malformed, abnormal WT + MO4-pitx2 standard conditions Fig. 1 with image from Liu et al., 2012
eye decreased size, abnormal WT + MO4-pitx2 standard conditions Fig. 1 with image,  Fig. 2 with image from Liu et al., 2012
pericardium edematous, abnormal WT + MO4-pitx2 standard conditions Fig. 1 with image from Liu et al., 2012
oral cavity malformed, abnormal WT + MO4-pitx2 standard conditions Fig. 3 with image,  Fig. 5 with image from Liu et al., 2012
mandibular arch skeleton morphology, abnormal WT + MO4-pitx2 standard conditions Fig. 1 with image from Liu et al., 2012
Meckel's cartilage hypoplastic, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image from Liu et al., 2012
trunk decreased length, abnormal WT + MO4-pitx2 standard conditions Fig. 1 with image from Liu et al., 2012
hyaloid vessel morphology, abnormal WT + MO4-pitx2 standard conditions Fig. 3 with image from Liu et al., 2012
whole organism viability, abnormal WT + MO4-pitx2 standard conditions Fig. 1 with image from Liu et al., 2012
palatoquadrate cartilage shape, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image from Liu et al., 2012
basihyal cartilage hypoplastic, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image from Liu et al., 2012
trunk kinked, abnormal WT + MO4-pitx2 standard conditions Fig. 1 with image from Liu et al., 2012
Meckel's cartilage shape, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image from Liu et al., 2012
ceratobranchial cartilage hypoplastic, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image from Liu et al., 2012
anterior segment eye structure, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image,  Fig. 5 with image from Liu et al., 2012
head decreased size, abnormal WT + MO4-pitx2 standard conditions Fig. 1 with image from Liu et al., 2012
ceratohyal cartilage position, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image from Liu et al., 2012
retina shape, abnormal WT + MO4-pitx2 standard conditions Fig. 5 with image from Liu et al., 2012
anterior segment eye cell disorganized, abnormal WT + MO4-pitx2 standard conditions Fig. 3 with image from Liu et al., 2012
Meckel's cartilage position, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image from Liu et al., 2012
mouth open, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image from Liu et al., 2012
anterior segment eye increased accumulation cell, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image,  Fig. 3 with image from Liu et al., 2012
ventral mandibular arch mislocalised ventrally, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image from Liu et al., 2012
palatoquadrate cartilage hypoplastic, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image from Liu et al., 2012
cornea morphology, abnormal WT + MO4-pitx2 standard conditions Fig. 5 with image from Liu et al., 2012
lens decreased size, abnormal WT + MO4-pitx2 standard conditions Fig. 5 with image from Liu et al., 2012
pharyngeal arch malformed, abnormal WT + MO4-pitx2 standard conditions Fig. 3 with image,  Fig. 5 with image from Liu et al., 2012
eye shape, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image from Liu et al., 2012
iris morphology, abnormal WT + MO4-pitx2 standard conditions Fig. 5 with image from Liu et al., 2012
basibranchial hypoplastic, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image from Liu et al., 2012
pharyngeal arch 2 skeleton mislocalised ventrally, abnormal WT + MO4-pitx2 standard conditions Fig. 2 with image from Liu et al., 2012
camera-type eye morphogenesis process quality, abnormal WT + MO4-pitx2 standard conditions Fig. 5 with image from Liu et al., 2012
hyaloid vessel disorganized, abnormal y1Tg + MO4-pitx2 standard conditions Fig. 5 with image from Liu et al., 2012
ocular blood vessel has extra parts of type hyaloid vessel, abnormal y1Tg + MO4-pitx2 standard conditions Fig. 5 with image from Liu et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.