Morpholino

MO5-disc1

ID
ZDB-MRPHLNO-111220-1
Name
MO5-disc1
Previous Names
None
Target
Sequence
5' - TCGCAGTTTTGTCTTACCTGTCCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-disc1
No data available
Phenotype
Phenotype resulting from MO5-disc1
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO5-disc1 text only from De Rienzo et al., 2011
axial mesoderm increased width, abnormal WT + MO5-disc1 Fig. 4 from De Rienzo et al., 2011
axial mesoderm sigmoid, abnormal WT + MO5-disc1 Fig. 4 from De Rienzo et al., 2011
brain morphology, abnormal WT + MO5-disc1 Fig. 4 with image from Singh et al., 2011
convergent extension involved in gastrulation disrupted, abnormal WT + MO5-disc1 Fig. 4 from De Rienzo et al., 2011
diencephalic white matter lacks parts or has fewer parts of type postoptic commissure, abnormal WT + MO5-disc1 Fig. 1 from De Rienzo et al., 2011
forebrain truncated, abnormal WT + MO5-disc1 Fig. 4 with image from Singh et al., 2011
forebrain ventricle decreased size, abnormal WT + MO5-disc1 Fig. 1 from De Rienzo et al., 2011
fourth ventricle decreased size, abnormal WT + MO5-disc1 Fig. 1 from De Rienzo et al., 2011
hindbrain neuron disorganized, abnormal WT + MO5-disc1 Fig. 1 from De Rienzo et al., 2011
MiP motor neuron decreased amount, abnormal WT + MO5-disc1 Fig. S3 from De Rienzo et al., 2011
muscle disorganized, abnormal WT + MO5-disc1 Fig. 4 with image from Singh et al., 2011
myotome U-shaped, abnormal WT + MO5-disc1 Fig. 1 from De Rienzo et al., 2011
nervous system development disrupted, abnormal WT + MO5-disc1 Fig. 1 from De Rienzo et al., 2011
post-vent region bent, abnormal WT + MO5-disc1 Fig. 1 from De Rienzo et al., 2011
Fig. 4 with image from Singh et al., 2011
primary motor neuron increased branchiness, abnormal WT + MO5-disc1 Fig. S3 from De Rienzo et al., 2011
somite condensed, abnormal WT + MO5-disc1 Fig. 4 from De Rienzo et al., 2011
somite increased width, abnormal WT + MO5-disc1 Fig. 4 from De Rienzo et al., 2011
spinal cord motor neuron differentiation disrupted, abnormal WT + MO5-disc1 Fig. S3 from De Rienzo et al., 2011
tectal ventricle decreased size, abnormal WT + MO5-disc1 Fig. 1 from De Rienzo et al., 2011
telencephalic white matter lacks parts or has fewer parts of type anterior commissure, abnormal WT + MO5-disc1 Fig. 1 from De Rienzo et al., 2011
ventricular system morphology, abnormal WT + MO5-disc1 Fig. 4 with image from Singh et al., 2011
white matter lacks parts or has fewer parts of type supraoptic tract, abnormal WT + MO5-disc1 Fig. 1 from De Rienzo et al., 2011
whole organism decreased length, abnormal WT + MO5-disc1 Fig. 4 from De Rienzo et al., 2011
whole organism lacks parts or has fewer parts of type cranial nerve V, abnormal rw0Tg + MO5-disc1 Fig. S3 from De Rienzo et al., 2011
whole organism lacks parts or has fewer parts of type cranial nerve VII, abnormal rw0Tg + MO5-disc1 Fig. S3 from De Rienzo et al., 2011
whole organism lacks parts or has fewer parts of type facial nerve motor nucleus, abnormal rw0Tg + MO5-disc1 Fig. S3 from De Rienzo et al., 2011
whole organism lacks parts or has fewer parts of type cranial nerve X, abnormal rw0Tg + MO5-disc1 Fig. S3 from De Rienzo et al., 2011
whole organism lacks parts or has fewer parts of type motor nucleus of vagal nerve, abnormal rw0Tg + MO5-disc1 Fig. S3 from De Rienzo et al., 2011
whole organism lacks parts or has fewer parts of type trigeminal motor nucleus, abnormal rw0Tg + MO5-disc1 Fig. S3 from De Rienzo et al., 2011
Phenotype of all Fish created by or utilizing MO5-disc1
Phenotype Fish Conditions Figures
convergent extension involved in gastrulation disrupted, abnormal WT + MO5-disc1 standard conditions Fig. 4 from De Rienzo et al., 2011
nervous system development disrupted, abnormal WT + MO5-disc1 standard conditions Fig. 1 from De Rienzo et al., 2011
primary motor neuron increased branchiness, abnormal WT + MO5-disc1 standard conditions Fig. S3 from De Rienzo et al., 2011
myotome U-shaped, abnormal WT + MO5-disc1 standard conditions Fig. 1 from De Rienzo et al., 2011
forebrain truncated, abnormal WT + MO5-disc1 standard conditions Fig. 4 with image from Singh et al., 2011
tectal ventricle decreased size, abnormal WT + MO5-disc1 standard conditions Fig. 1 from De Rienzo et al., 2011
forebrain ventricle decreased size, abnormal WT + MO5-disc1 standard conditions Fig. 1 from De Rienzo et al., 2011
apoptotic process increased occurrence, abnormal WT + MO5-disc1 standard conditions text only from De Rienzo et al., 2011
telencephalic white matter lacks parts or has fewer parts of type anterior commissure, abnormal WT + MO5-disc1 standard conditions Fig. 1 from De Rienzo et al., 2011
fourth ventricle decreased size, abnormal WT + MO5-disc1 standard conditions Fig. 1 from De Rienzo et al., 2011
whole organism decreased length, abnormal WT + MO5-disc1 standard conditions Fig. 4 from De Rienzo et al., 2011
white matter lacks parts or has fewer parts of type supraoptic tract, abnormal WT + MO5-disc1 standard conditions Fig. 1 from De Rienzo et al., 2011
spinal cord motor neuron differentiation disrupted, abnormal WT + MO5-disc1 standard conditions Fig. S3 from De Rienzo et al., 2011
somite increased width, abnormal WT + MO5-disc1 standard conditions Fig. 4 from De Rienzo et al., 2011
hindbrain neuron disorganized, abnormal WT + MO5-disc1 standard conditions Fig. 1 from De Rienzo et al., 2011
axial mesoderm sigmoid, abnormal WT + MO5-disc1 standard conditions Fig. 4 from De Rienzo et al., 2011
axial mesoderm increased width, abnormal WT + MO5-disc1 standard conditions Fig. 4 from De Rienzo et al., 2011
muscle disorganized, abnormal WT + MO5-disc1 standard conditions Fig. 4 with image from Singh et al., 2011
MiP motor neuron decreased amount, abnormal WT + MO5-disc1 standard conditions Fig. S3 from De Rienzo et al., 2011
brain morphology, abnormal WT + MO5-disc1 standard conditions Fig. 4 with image from Singh et al., 2011
post-vent region bent, abnormal WT + MO5-disc1 standard conditions Fig. 1 from De Rienzo et al., 2011
Fig. 4 with image from Singh et al., 2011
ventricular system morphology, abnormal WT + MO5-disc1 standard conditions Fig. 4 with image from Singh et al., 2011
somite condensed, abnormal WT + MO5-disc1 standard conditions Fig. 4 from De Rienzo et al., 2011
diencephalic white matter lacks parts or has fewer parts of type postoptic commissure, abnormal WT + MO5-disc1 standard conditions Fig. 1 from De Rienzo et al., 2011
whole organism lacks parts or has fewer parts of type cranial nerve X, abnormal rw0Tg + MO5-disc1 standard conditions Fig. S3 from De Rienzo et al., 2011
whole organism lacks parts or has fewer parts of type cranial nerve V, abnormal rw0Tg + MO5-disc1 standard conditions Fig. S3 from De Rienzo et al., 2011
whole organism lacks parts or has fewer parts of type motor nucleus of vagal nerve, abnormal rw0Tg + MO5-disc1 standard conditions Fig. S3 from De Rienzo et al., 2011
whole organism lacks parts or has fewer parts of type cranial nerve VII, abnormal rw0Tg + MO5-disc1 standard conditions Fig. S3 from De Rienzo et al., 2011
whole organism lacks parts or has fewer parts of type facial nerve motor nucleus, abnormal rw0Tg + MO5-disc1 standard conditions Fig. S3 from De Rienzo et al., 2011
whole organism lacks parts or has fewer parts of type trigeminal motor nucleus, abnormal rw0Tg + MO5-disc1 standard conditions Fig. S3 from De Rienzo et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.