header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-111212-4
Morpholino Name: MO6-spi1b
Target: spi1b (1)
Previous Name: MO6-spi1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AATAACTGATACAAACTCACCGTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-spi1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-spi1b
Expressed Gene Anatomy Figures
apoeb Fig. 1 from Jin et al., 2012
Fig. 6 from Li et al., 2011
cebp1 Fig. 1 from Jin et al., 2012
csf1ra Fig. 6 from Li et al., 2011
irf8 Fig. 6 from Li et al., 2011
runx1 Fig. 3 from Jin et al., 2012
PHENOTYPE
Phenotype resulting from MO6-spi1b
Phenotype of all Fish created by or utilizing MO6-spi1b
Genome Resources:
CITATIONS (3)