header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-111212-3
Morpholino Name: MO2-irf8
Target: irf8 (1)
Previous Name: irf8 MOatg (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCAGTCTGCGACCGCCCGAGTTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-irf8 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-irf8
Expressed Gene Anatomy Figures
lyz Fig. S8 from He et al., 2015
mfap4 Fig. S8 from He et al., 2015
runx1 Fig. S8 from He et al., 2015
PHENOTYPE
Phenotype resulting from MO2-irf8
Phenotype of all Fish created by or utilizing MO2-irf8
OTHER MO2-irf8 MORPHOLINO PAGESNo links to external sites
CITATIONS (7)