Morpholino
MO1-hdac6
- ID
- ZDB-MRPHLNO-111111-1
- Name
- MO1-hdac6
- Previous Names
-
- HDAC6-TB-Mo (1)
- Target
- Sequence
-
5' - CTTTGGTATCTGGAACCGCATCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hdac6
Expressed Gene | Anatomy | Figures |
---|---|---|
abcc1 |
Fig. 3
from Pezzotta et al., 2022 |
|
asxl1 |
Fig. 3
from Pezzotta et al., 2022 |
|
gli1 |
Fig. 3
from Pezzotta et al., 2022 |
1 - 3 of 3
Phenotype
Phenotype resulting from MO1-hdac6
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-hdac6
1 - 5 of 7 Show all
Citations
- Pezzotta, A., Gentile, I., Genovese, D., Totaro, M.G., Battaglia, C., Leung, A.Y., Fumagalli, M., Parma, M., Cazzaniga, G., Fazio, G., Alcalay, M., Marozzi, A., Pistocchi, A. (2022) HDAC6 inhibition decreases leukemic stem cell expansion driven by Hedgehog hyperactivation by restoring primary ciliogenesis. Pharmacological research. 183:106378
- Volpatti, J.R., Ghahramani-Seno, M.M., Mansat, M., Sabha, N., Sarikaya, E., Goodman, S.J., Chater-Diehl, E., Celik, A., Pannia, E., Froment, C., Combes-Soia, L., Maani, N., Yuki, K.E., Chicanne, G., Uusküla-Reimand, L., Monis, S., Alvi, S.A., Genetti, C.A., Payrastre, B., Beggs, A.H., Bonnemann, C.G., Muntoni, F., Wilson, M.D., Weksberg, R., Viaud, J., Dowling, J.J. (2022) X-linked myotubular myopathy is associated with epigenetic alterations and is ameliorated by HDAC inhibition. Acta Neuropathologica. 144(3):537-563
- Zhuang, M., Scholz, A., Walz, G., Yakulov, T.A. (2022) Histone Deacetylases Cooperate with NF-κB to Support the Immediate Migratory Response after Zebrafish Pronephros Injury. International Journal of Molecular Sciences. 23(17)
- Kaluza, D., Kroll, J., Gesierich, S., Yao, T.P., Boon, R.A., Hergenreider, E., Tjwa, M., Rössig, L., Seto, E., Augustin, H.G., Zeiher, A.M., Dimmeler, S., and Urbich, C. (2011) Class IIb HDAC6 regulates endothelial cell migration and angiogenesis by deacetylation of cortactin. The EMBO journal. 30(20):4142-56
1 - 4 of 4
Show