Morpholino

MO2-foxo3b

ID
ZDB-MRPHLNO-110929-10
Name
MO2-foxo3b
Previous Names
  • foxo3b-SP-MO (1)
Target
Sequence
5' - TGGAGATGCACTGCGCTTACCTTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 20
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-foxo3b
Expressed Gene Anatomy Figures
hmx3a Fig. 3 with image from Xie et al., 2011
ifnphi1 Fig. 12 from Liu et al., 2016
mxc Fig. 12 from Liu et al., 2016
pax6a Fig. 3 with image from Xie et al., 2011
pkz Fig. 12 from Liu et al., 2016
tbx5a Fig. 3 with image from Xie et al., 2011
tsc22d3 Fig. S8 from Hoppstädter et al., 2020
vhl Fig. 7 from Liu et al., 2016
Phenotype
Phenotype resulting from MO2-foxo3b
Phenotype Fish Figures
brain malformed, abnormal AB + MO2-foxo3b Fig. 2 with image from Xie et al., 2011
eye decreased size, abnormal AB + MO2-foxo3b Fig. 2 with image from Xie et al., 2011
head decreased thickness, abnormal AB + MO2-foxo3b Fig. 2 with image from Xie et al., 2011
heart malformed, abnormal AB + MO2-foxo3b Fig. 2 with image from Xie et al., 2011
neural tube patterning disrupted, abnormal AB + MO2-foxo3b Fig. 3 with image from Xie et al., 2011
whole organism tsc22d3 expression decreased amount, abnormal AB + MO2-foxo3b Fig. S8 from Hoppstädter et al., 2020
whole organism vhl expression decreased amount, abnormal AB + MO2-foxo3b Fig. 7 from Liu et al., 2016
whole organism decreased length, abnormal AB + MO2-foxo3b Fig. S8 from Hoppstädter et al., 2020
Fig. 2 with image from Xie et al., 2011
whole organism ifnphi1 expression increased amount, abnormal AB + MO2-foxo3b Fig. 12 from Liu et al., 2016
whole organism mxc expression increased amount, abnormal AB + MO2-foxo3b Fig. 12 from Liu et al., 2016
whole organism pkz expression increased amount, abnormal AB + MO2-foxo3b Fig. 12 from Liu et al., 2016
Phenotype of all Fish created by or utilizing MO2-foxo3b
Phenotype Fish Conditions Figures
whole organism pkz expression increased amount, abnormal AB + MO2-foxo3b standard conditions Fig. 12 from Liu et al., 2016
whole organism tsc22d3 expression decreased amount, abnormal AB + MO2-foxo3b standard conditions Fig. S8 from Hoppstädter et al., 2020
heart malformed, abnormal AB + MO2-foxo3b standard conditions Fig. 2 with image from Xie et al., 2011
neural tube patterning disrupted, abnormal AB + MO2-foxo3b standard conditions Fig. 3 with image from Xie et al., 2011
head decreased thickness, abnormal AB + MO2-foxo3b standard conditions Fig. 2 with image from Xie et al., 2011
whole organism tsc22d3 expression amount, ameliorated AB + MO2-foxo3b chemical treatment by environment: simvastatin Fig. S8 from Hoppstädter et al., 2020
whole organism vhl expression decreased amount, abnormal AB + MO2-foxo3b standard conditions Fig. 7 from Liu et al., 2016
whole organism mxc expression increased amount, abnormal AB + MO2-foxo3b standard conditions Fig. 12 from Liu et al., 2016
eye decreased size, abnormal AB + MO2-foxo3b standard conditions Fig. 2 with image from Xie et al., 2011
whole organism decreased length, abnormal AB + MO2-foxo3b standard conditions Fig. S8 from Hoppstädter et al., 2020
Fig. 2 with image from Xie et al., 2011
whole organism ifnphi1 expression increased amount, abnormal AB + MO2-foxo3b standard conditions Fig. 12 from Liu et al., 2016
brain malformed, abnormal AB + MO2-foxo3b standard conditions Fig. 2 with image from Xie et al., 2011
Citations
TSV
1 - 4 of 4
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.