ZFIN ID: ZDB-MRPHLNO-110928-15
Morpholino Name: MO2-ifngr1
Target: ifngr1 (1)
Previous Names: MO2-crfb17, MO2-ifngr1l

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTAAACTAAATCGCCTTACCTTGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ifngr1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ifngr1
Expressed Gene Anatomy Figures
runx1 Fig. 1 with image from Sawamiphak et al., 2014
PHENOTYPE
Phenotype resulting from MO2-ifngr1
Phenotype Figures
endothelial cell cell population proliferation increased rate, abnormal Fig. S4 with image from Sawamiphak et al., 2014

Phenotype of all Fish created by or utilizing MO2-ifngr1
Phenotype Fish Conditions Figures
endothelial cell cell population proliferation increased rate, abnormal la2Tg; s896Tg + MO2-ifngr1 standard conditions Fig. S4 with image from Sawamiphak et al., 2014
OTHER MO2-ifngr1 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)