Morpholino
MO1-leg1.2
- ID
- ZDB-MRPHLNO-110921-5
- Name
- MO1-leg1.2
- Previous Names
-
- leg1b-MO (1)
- Target
- Sequence
-
5' - CCGGGCCACATACTGAATGGAATGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-leg1.2
No data available
Phenotype
Phenotype resulting from MO1-leg1.2
Phenotype | Fish | Figures |
---|---|---|
liver decreased size, abnormal | AB + MO1-leg1.2 |
Fig. 5 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-leg1.2
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
liver decreased size, abnormal | AB + MO1-leg1.2 | standard conditions |
Fig. 5 ![]() |
1 - 1 of 1
Citations
- Xie, A., Ma, Z., Wang, J., Zhang, Y., Chen, Y., Yang, C., Chen, J., Peng, J. (2023) Upf3a but not Upf1 mediates the genetic compensation response induced by leg1 deleterious mutations in an H3K4me3-independent manner. Cell discovery. 9:6363
- Wang, J., Bai, Y., Xie, A., Huang, H., Hu, M., Peng, J. (2021) Difference in an intermolecular disulfide-bond between two highly homologous serum proteins Leg1a and Leg1b implicates their functional differentiation. Biochemical and Biophysical Research Communications. 579:81-88
- Chang, C., Hu, M., Zhu, Z., Lo, L.J., Chen, J., and Peng, J. (2011) liver-enriched gene 1a and 1b Encode Novel Secretory Proteins Essential for Normal Liver Development in Zebrafish. PLoS One. 6(8):e22910
1 - 3 of 3
Show