Morpholino
MO1-nr2f2
- ID
- ZDB-MRPHLNO-110809-1
- Name
- MO1-nr2f2
- Previous Names
-
- NR2F2 ATG (1)
- Target
- Sequence
-
5' - AGCCTCTCCACACTACCATTGCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nr2f2
No data available
Phenotype
Phenotype resulting from MO1-nr2f2
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-nr2f2
1 - 5 of 7 Show all
Citations
- Kashiwada, T., Fukuhara, S., Terai, K., Tanaka, T., Wakayama, Y., Ando, K., Nakajima, H., Fukui, H., Yuge, S., Saito, Y., Gemma, A., Mochizuki, N. (2015) β-catenin-dependent transcription is central to Bmp-mediated formation of venous vessels. Development (Cambridge, England). 142(3):497-509
- Samarut, E., Gaudin, C., Hughes, S., Gillet, B., de Bernard, S., Jouve, P.E., Buffat, L., Allot, A., Lecompte, O., Berekelya, L., Rochette-Egly, C., and Laudet, V. (2014) Retinoic acid receptor subtype-specific transcriptotypes in the early zebrafish embryo. Molecular endocrinology (Baltimore, Md.). 28(2):260-272
- Swift, M.R., Pham, V.N., Castranova, D., Bell, K., Poole, R.J., Weinstein, B.M. (2014) SoxF factors and Notch regulate nr2f2 gene expression during venous differentiation in zebrafish. Developmental Biology. 390:116-25
- Aranguren, X.L., Beerens, M., Vandevelde, W., Dewerchin, M., Carmeliet, P., and Luttun, A. (2011) Transcription factor COUP-TFII is indispensable for venous and lymphatic development in zebrafish and Xenopus laevis. Biochemical and Biophysical Research Communications. 410(1):121-6
1 - 4 of 4
Show