Morpholino

MO1-nr2f2

ID
ZDB-MRPHLNO-110809-1
Name
MO1-nr2f2
Previous Names
  • NR2F2 ATG (1)
Target
Sequence
5' - AGCCTCTCCACACTACCATTGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nr2f2
Expressed Gene Anatomy Figures
dab2 Fig. 2 with image from Swift et al., 2014
efnb2a Fig. 2 with image,  Fig. 3 with image from Swift et al., 2014
Fig. 1 from Aranguren et al., 2011
ephb4a Fig. 2 with image from Swift et al., 2014
Fig. 1 from Aranguren et al., 2011
flt4 Fig. 1 from Aranguren et al., 2011
hey2 Fig. 2 with image from Swift et al., 2014
Fig. 1 from Aranguren et al., 2011
lyve1b Fig. 2 with image,  Fig. 3 with image from Swift et al., 2014
prox1a Fig. 2 with image from Swift et al., 2014
Fig. 2 from Aranguren et al., 2011
sox7 Fig. 2 with image from Swift et al., 2014
sox18 Fig. 2 with image from Swift et al., 2014
stab1 Fig. 2 with image from Swift et al., 2014
tbx20 Fig. 2 with image from Swift et al., 2014
Phenotype
Phenotype resulting from MO1-nr2f2
Phenotype Fish Figures
dorsal aorta fused with posterior cardinal vein, abnormal y1Tg + MO1-nr2f2 Fig. S2 from Aranguren et al., 2011
intersegmental vessel branchiness, abnormal y1Tg + MO1-nr2f2 Fig. S2 from Aranguren et al., 2011
pericardium edematous, abnormal WT + MO1-nr2f2 Fig. S2 from Aranguren et al., 2011
post-vent vasculature structure, abnormal y1Tg + MO1-nr2f2 Fig. S2 from Aranguren et al., 2011
posterior cardinal vein venous blood vessel development process quality, abnormal EKW + MO1-nr2f2 Fig. 2 with image,  Fig. 3 with image from Swift et al., 2014
thoracic duct immature, abnormal y1Tg + MO1-nr2f2 Fig. 2 from Aranguren et al., 2011
trunk vasculature non-functional, abnormal sd2Tg; y1Tg + MO1-nr2f2 Fig. 1 from Aranguren et al., 2011
Phenotype of all Fish created by or utilizing MO1-nr2f2
Phenotype Fish Conditions Figures
posterior cardinal vein venous blood vessel development process quality, abnormal EKW + MO1-nr2f2 standard conditions Fig. 2 with image,  Fig. 3 with image from Swift et al., 2014
pericardium edematous, abnormal WT + MO1-nr2f2 standard conditions Fig. S2 from Aranguren et al., 2011
thoracic duct immature, abnormal y1Tg + MO1-nr2f2 standard conditions Fig. 2 from Aranguren et al., 2011
intersegmental vessel branchiness, abnormal y1Tg + MO1-nr2f2 standard conditions Fig. S2 from Aranguren et al., 2011
post-vent vasculature structure, abnormal y1Tg + MO1-nr2f2 standard conditions Fig. S2 from Aranguren et al., 2011
dorsal aorta fused with posterior cardinal vein, abnormal y1Tg + MO1-nr2f2 standard conditions Fig. S2 from Aranguren et al., 2011
trunk vasculature non-functional, abnormal sd2Tg; y1Tg + MO1-nr2f2 standard conditions Fig. 1 from Aranguren et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.