Morpholino
MO2-nr0b1
- ID
- ZDB-MRPHLNO-110630-5
- Name
- MO2-nr0b1
- Previous Names
- 
    
        
    
    
        
        - dax1 MO3 (1)
 
- Target
- Sequence
- 
    
        
        
    
        
            
                5' - CTGAGCTGCACGCTTGGAGATGATC - 3'
                
            
            
                
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- 
    
        
        
    
        
            This morpholino targets the 5'UTR. The authors were contacted to confirm the sequence and the corrected sequence is listed here. There is an imperfect match between this morpholino and the current build.
- Genome Resources
- None
                
                    
                        Target Location
                    
                    
                
                
            
        
        
    
        
            
            
    
        
    
    
    
        
        
    
    
    
                
                    
                        Genomic Features
                    
                    
                
                
            
        
        
    
        
            
            
    
    
        
    
No data available
    
        
        
    
    
    
                
                    
                        Expression
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Gene expression in Wild Types + MO2-nr0b1
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Phenotype resulting from MO2-nr0b1
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype of all Fish created by or utilizing MO2-nr0b1
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    