Morpholino

MO5-lmna

ID

ZDB-MRPHLNO-110601-2

Name

MO5-lmna

Previous Names

Target

Sequence

5' - CATGGTTGTCTGGAACTACTGATA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

translation blocker

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-lmna

No data available

Phenotype

Phenotype resulting from MO5-lmna

Phenotype	Fish	Figures
brain apoptotic, abnormal	WT + MO5-lmna	Fig. 5 from Koshimizu et al., 2011
ceratohyal cartilage mislocalised posteriorly, abnormal	WT + MO5-lmna	Fig. 4 from Koshimizu et al., 2011
fat cell decreased amount, abnormal	WT + MO5-lmna	Fig. S6 from Koshimizu et al., 2011
fat cell differentiation decreased occurrence, abnormal	WT + MO5-lmna	Fig. S6 from Koshimizu et al., 2011
Meckel's cartilage alignment palatoquadrate cartilage, abnormal	WT + MO5-lmna	Fig. 4 from Koshimizu et al., 2011
mitotic M phase duration, abnormal	WT + MO5-lmna	Fig. 5 from Koshimizu et al., 2011
mitotic S phase duration, abnormal	WT + MO5-lmna	Fig. 5 from Koshimizu et al., 2011
myotome slow muscle cell decreased amount, abnormal	WT + MO5-lmna	Fig. 4 from Koshimizu et al., 2011
trunk apoptotic, abnormal	WT + MO5-lmna	Fig. 5 from Koshimizu et al., 2011

Phenotype of all Fish created by or utilizing MO5-lmna

Phenotype	Fish	Conditions	Figures
mitotic S phase duration, abnormal	WT + MO5-lmna	standard conditions	Fig. 5 from Koshimizu et al., 2011
brain apoptotic, abnormal	WT + MO5-lmna	standard conditions	Fig. 5 from Koshimizu et al., 2011
myotome slow muscle cell decreased amount, abnormal	WT + MO5-lmna	standard conditions	Fig. 4 from Koshimizu et al., 2011
ceratohyal cartilage mislocalised posteriorly, abnormal	WT + MO5-lmna	standard conditions	Fig. 4 from Koshimizu et al., 2011
fat cell differentiation decreased occurrence, abnormal	WT + MO5-lmna	standard conditions	Fig. S6 from Koshimizu et al., 2011
mitotic M phase duration, abnormal	WT + MO5-lmna	standard conditions	Fig. 5 from Koshimizu et al., 2011
trunk apoptotic, abnormal	WT + MO5-lmna	standard conditions	Fig. 5 from Koshimizu et al., 2011
Meckel's cartilage alignment palatoquadrate cartilage, abnormal	WT + MO5-lmna	standard conditions	Fig. 4 from Koshimizu et al., 2011
fat cell decreased amount, abnormal	WT + MO5-lmna	standard conditions	Fig. S6 from Koshimizu et al., 2011

Citations