Morpholino

MO1-thsd7aa

ID
ZDB-MRPHLNO-110531-1
Name
MO1-thsd7aa
Previous Names
None
Target
Sequence
5' - TGTATGTTTTTACCCACCATGACTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-thsd7aa
No data available
Phenotype
Phenotype resulting from MO1-thsd7aa
Phenotype of all Fish created by or utilizing MO1-thsd7aa
Phenotype Fish Conditions Figures
heart notch1b expression mislocalised, abnormal AB + MO1-thsd7aa standard conditions Fig. 5 with image from Liu et al., 2016
whole organism nrarpb expression decreased amount, abnormal AB + MO1-thsd7aa standard conditions Fig. 6 from Liu et al., 2016
atrioventricular canal development process quality, abnormal AB + MO1-thsd7aa standard conditions Fig. 5 with image from Liu et al., 2016
whole organism kdrl expression decreased amount, abnormal AB + MO1-thsd7aa standard conditions Fig. 6 from Liu et al., 2016
whole organism thsd7aa expression decreased amount, abnormal AB + MO1-thsd7aa standard conditions Fig. 4 from Liu et al., 2016
whole organism flt4 expression decreased amount, abnormal AB + MO1-thsd7aa standard conditions Fig. 6 from Liu et al., 2016
spinal cord notch1b expression decreased amount, abnormal AB + MO1-thsd7aa standard conditions Fig. 5 with image from Liu et al., 2016
heart looping decreased occurrence, abnormal AB + MO1-thsd7aa standard conditions Fig. 5 with image from Liu et al., 2016
hindbrain notch1b expression spatial pattern, abnormal AB + MO1-thsd7aa standard conditions Fig. 5 with image from Liu et al., 2016
whole organism notch1b expression decreased amount, abnormal AB + MO1-thsd7aa standard conditions Fig. 4 from Liu et al., 2016
blood vessel endothelial cell migration disrupted, abnormal y1Tg + MO1-thsd7aa standard conditions Fig. 4 with imageFig. 5 with image from Wang et al., 2011
intersegmental vessel increased branchiness, abnormal y1Tg + MO1-thsd7aa standard conditions Fig. 4 with image from Wang et al., 2011
intersegmental vessel spatial pattern, abnormal y1Tg + MO1-thsd7aa standard conditions Fig. 4 with imageFig. 5 with image from Wang et al., 2011
parachordal vessel angiogenesis decreased occurrence, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
MiP motor neuron axon development process quality, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
secondary motor neuron axon development process quality, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
RoP motor neuron axon absent, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
MiP motor neuron axon decreased length, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
RoP motor neuron axon morphology, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
secondary motor neuron axon morphology, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
horizontal myoseptum lacks parts or has fewer parts of type RoP motor neuron axon, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
RoP motor neuron axon development decreased occurrence, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
MiP motor neuron axon morphology, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
parachordal vessel absent, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
parachordal vessel aplastic, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
Citations