Morpholino

MO2-irx2a

ID
ZDB-MRPHLNO-110209-1
Name
MO2-irx2a
Previous Names
None
Target
Sequence
5' - ACGGAGAGCCCTTCAAAAATAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-irx2a
No data available
Phenotype
Phenotype resulting from MO2-irx2a
Phenotype Fish Figures
pronephric distal late tubule decreased length, abnormal TU + MO2-irx2a Figure 2 with image from Marra et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal TU + MO2-irx2a Figure 2 with image from Marra et al., 2019
pronephric proximal straight tubule increased length, abnormal TU + MO2-irx2a Figure 2 with image from Marra et al., 2019
pronephric proximal straight tubule pronephric nephron tubule epithelial cell differentiation increased occurrence, abnormal TU + MO2-irx2a Figure 2 with image from Marra et al., 2019
pronephric tubule etv5a expression decreased distribution, abnormal TU + MO2-irx2a Figure 3 with image from Marra et al., 2019
pronephric tubule has fewer parts of type pronephric tubule multi-ciliated epithelial cell, abnormal TU + MO2-irx2a Figure 4 with image from Marra et al., 2019
pronephric tubule multi-ciliated epithelial cell differentiation decreased occurrence, abnormal TU + MO2-irx2a Figure 4 with image from Marra et al., 2019
retina lacks parts or has fewer parts of type retinal inner plexiform layer, abnormal WT + MO2-irx2a Fig. 3 with image from Choy et al., 2010
retina lacks parts or has fewer parts of type retinal outer plexiform layer, abnormal WT + MO2-irx2a Fig. 3 with image from Choy et al., 2010
retina layer formation disrupted, abnormal WT + MO2-irx2a Fig. 3 with image from Choy et al., 2010
retinal ganglion cell layer hypoplastic, abnormal WT + MO2-irx2a Fig. 3 with image from Choy et al., 2010
retinal inner nuclear layer hypoplastic, abnormal WT + MO2-irx2a Fig. 3 with image from Choy et al., 2010
whole organism lacks all parts of type cranial nerve II, abnormal WT + MO2-irx2a Fig. 3 with image from Choy et al., 2010
Phenotype of all Fish created by or utilizing MO2-irx2a
Phenotype Fish Conditions Figures
pronephric proximal straight tubule pronephric nephron tubule epithelial cell differentiation increased occurrence, abnormal TU + MO2-irx2a standard conditions Figure 2 with image from Marra et al., 2019
pronephric tubule etv5a expression decreased distribution, abnormal TU + MO2-irx2a control Figure 3 with image from Marra et al., 2019
pronephric tubule has fewer parts of type pronephric tubule multi-ciliated epithelial cell, abnormal TU + MO2-irx2a standard conditions Figure 4 with image from Marra et al., 2019
pronephric distal late tubule decreased length, abnormal TU + MO2-irx2a standard conditions Figure 2 with image from Marra et al., 2019
pronephric proximal straight tubule increased length, abnormal TU + MO2-irx2a standard conditions Figure 2 with image from Marra et al., 2019
pronephric tubule multi-ciliated epithelial cell differentiation decreased occurrence, abnormal TU + MO2-irx2a standard conditions Figure 4 with image from Marra et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal TU + MO2-irx2a standard conditions Figure 2 with image from Marra et al., 2019
retina layer formation disrupted, abnormal WT + MO2-irx2a standard conditions Fig. 3 with image from Choy et al., 2010
whole organism lacks all parts of type cranial nerve II, abnormal WT + MO2-irx2a standard conditions Fig. 3 with image from Choy et al., 2010
retinal ganglion cell layer hypoplastic, abnormal WT + MO2-irx2a standard conditions Fig. 3 with image from Choy et al., 2010
eye decreased size, abnormal WT + MO2-irx2a high light intensity Fig. 2 with image from Choy et al., 2010
whole organism increased pigmentation, abnormal WT + MO2-irx2a high light intensity Fig. 2 with image from Choy et al., 2010
retina lacks parts or has fewer parts of type retinal outer plexiform layer, abnormal WT + MO2-irx2a standard conditions Fig. 3 with image from Choy et al., 2010
retinal inner nuclear layer hypoplastic, abnormal WT + MO2-irx2a standard conditions Fig. 3 with image from Choy et al., 2010
retina lacks parts or has fewer parts of type retinal inner plexiform layer, abnormal WT + MO2-irx2a standard conditions Fig. 3 with image from Choy et al., 2010
eye decreased size, abnormal WT + MO2-atoh7 + MO2-irx2a standard conditions Fig. 6 with image from Choy et al., 2010
eye decreased size, abnormal WT + MO2-irx2a + MO4-irx1a standard conditions Fig. 6 with image from Choy et al., 2010
Citations