Morpholino
MO3-alcama
- ID
- ZDB-MRPHLNO-110125-4
- Name
- MO3-alcama
- Previous Names
-
- TB MO (1)
- Target
- Sequence
-
5' - GTTCTCCTTTATACAGTCCGGCGAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-alcama
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| myl7 |
Fig. 7 
from Choudhry et al., 2013 |
|
| notch1b |
Fig. 7
from Choudhry et al., 2013 |
1 - 2 of 2
Phenotype
Phenotype resulting from MO3-alcama
| Phenotype | Fish | Figures |
|---|---|---|
| heart looping disrupted, abnormal | WT + MO3-alcama |
Fig. 7
from Choudhry et al., 2013 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO3-alcama
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| heart looping disrupted, abnormal | WT + MO3-alcama | standard conditions |
Fig. 7
from Choudhry et al., 2013 |
1 - 1 of 1
Citations
- Choudhry, P., and Trede, N.S. (2013) DiGeorge Syndrome Gene tbx1 Functions through wnt11r to Regulate Heart Looping and Differentiation. PLoS One. 8(3):e58145
- Choudhry, P., Joshi, D., Funke, B., and Trede, N. (2011) Alcama mediates Edn1 signaling during zebrafish cartilage morphogenesis. Developmental Biology. 349(2):483-493
1 - 2 of 2
Show