ZFIN ID: ZDB-MRPHLNO-110111-4
Morpholino Name: MO2-col19a1
Target: col19a1 (1)
Previous Name: colXIX MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGCAAACCCTGCAAGCCAAAGGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: splice-blocker targeted to exon 17-18 junction
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-col19a1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-col19a1
Expressed Gene Anatomy Figures
col19a1 Fig. 3 with image from Hilario et al., 2010
PHENOTYPE
Phenotype resulting from MO2-col19a1
Phenotype of all Fish created by or utilizing MO2-col19a1
Genome Resources:
CITATIONS (2)