Morpholino

MO3-mcamb

ID
ZDB-MRPHLNO-101216-2
Name
MO3-mcamb
Previous Names
  • gicerin MO (1)
Target
Sequence
5' - AGCAGTGCGGTGTAGGTCATTTCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-mcamb
No data available
Phenotype
Phenotype resulting from MO3-mcamb
Phenotype Fish Figures
angiogenesis arrested, abnormal WT + MO3-mcamb Fig. 3 from So et al., 2010
angiogenesis disrupted, abnormal la116Tg; vu19Tg + MO3-mcamb Fig. 3Fig. 4 from So et al., 2010
blood circulation disrupted, abnormal WT + MO3-mcamb Fig. 3 from So et al., 2010
blood vessel endothelial cell migration decreased process quality, abnormal is5Tg; y7Tg + MO3-mcamb Fig. S6 from Tu et al., 2015
blood vessel endothelial cell proliferation involved in sprouting angiogenesis decreased process quality, abnormal is5Tg; y7Tg + MO3-mcamb Fig. S6 from Tu et al., 2015
convergent extension process quality, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
determination of digestive tract left/right asymmetry decreased occurrence, abnormal TU + MO3-mcamb Fig. 4 with image from Gao et al., 2017
determination of intestine left/right asymmetry decreased occurrence, abnormal TU + MO3-mcamb Fig. 4 with image from Gao et al., 2017
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal TU + MO3-mcamb Fig. 3 with image from Gao et al., 2017
determination of pancreatic left/right asymmetry decreased occurrence, abnormal TU + MO3-mcamb Fig. 4 with image from Gao et al., 2017
dorsal longitudinal anastomotic vessel aplastic, abnormal la116Tg + MO3-mcamb Fig. 4 from So et al., 2010
epithelial cilium movement involved in determination of left/right asymmetry process quality, abnormal TU + MO3-mcamb Fig. 3 with image from Gao et al., 2017
heart looping decreased occurrence, abnormal TU + MO3-mcamb Fig. 4 with image from Gao et al., 2017
intersegmental vessel aplastic, abnormal WT + MO3-mcamb Fig. 3 from So et al., 2010
intersegmental vessel decreased amount, abnormal la116Tg; vu19Tg + MO3-mcamb Fig. 3 from So et al., 2010
intersegmental vessel decreased length, abnormal la116Tg + MO3-mcamb Fig. 4 from So et al., 2010
intersegmental vessel hypoplastic, abnormal la116Tg; vu19Tg + MO3-mcamb Fig. 3 from So et al., 2010
intersegmental vessel endothelial cell decreased amount, abnormal is5Tg; y7Tg + MO3-mcamb Fig. 6 with image from Tu et al., 2015
Kupffer's vesicle decreased size, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle lumenized, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle shape, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle unlumenized, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle anatomical region decreased volume, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle anatomical space decreased volume, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle cilium decreased length, abnormal TU + MO3-mcamb Fig. 3 with image from Gao et al., 2017
Kupffer's vesicle tube formation decreased occurrence, abnormal s870Tg + MO3-mcamb Fig. 2 with image from Gao et al., 2017
lateral plate mesoderm spaw expression spatial pattern, abnormal TU + MO3-mcamb Fig. 3 with image from Gao et al., 2017
lateral plate mesoderm right side spaw expression spatial pattern, abnormal TU + MO3-mcamb Fig. 3 with image from Gao et al., 2017
lymphangiogenesis decreased occurrence, abnormal y1Tg + MO3-mcamb Fig. 5 with image from Yan et al., 2017
lymphangiogenic sprout decreased amount, abnormal y1Tg + MO3-mcamb Fig. 5 with image from Yan et al., 2017
neuroectoderm dlx3b expression spatial pattern, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
notochord increased width, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
notochord tbxta expression spatial pattern, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
pericardium edematous, abnormal WT + MO3-mcamb Fig. 3 from So et al., 2010
prechordal plate ctslb expression spatial pattern, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
somite morphology, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
somite myod1 expression spatial pattern, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
thoracic duct absent, abnormal y1Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
thoracic duct prox3 expression decreased amount, abnormal TU + MO3-mcamb Fig. S5 with image from Yan et al., 2017
thoracic duct prox1a expression decreased amount, abnormal TU + MO3-mcamb Fig. S5 with image from Yan et al., 2017
thoracic duct lyve1b expression decreased amount, abnormal TU + MO3-mcamb Fig. S5 with image from Yan et al., 2017
thoracic duct decreased amount, abnormal y1Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
thoracic duct decreased functionality, abnormal ci5Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
thoracic duct decreased length, abnormal y1Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
thoracic duct malformed, abnormal ci5Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
thoracic duct lymphangiogenesis decreased occurrence, abnormal y1Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
vascular lymphangioblast absent, abnormal y1Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
vascular lymphangioblast lymphangiogenesis decreased occurrence, abnormal y1Tg + MO3-mcamb Fig. 6 with image from Yan et al., 2017
vasculature development disrupted, abnormal la116Tg + MO3-mcamb Fig. 6 with image from Tu et al., 2015
whole organism ab21-mapk labeling decreased amount, abnormal TU + MO3-mcamb Fig. 5 from Ye et al., 2013
whole organism axin2 expression decreased amount, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism ab14-ctnnb labeling increased amount, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism vent expression increased amount, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism vox expression increased amount, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism lacks all parts of type parachordal vessel, abnormal la116Tg + MO3-mcamb Fig. 6 with image from Tu et al., 2015
whole organism dorsal region dharma expression increased amount, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism dorsal region dharma expression increased distribution, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism ventral region vent expression increased amount, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
whole organism ventral region vent expression increased distribution, abnormal TU + MO3-mcamb Fig. 6 from Ye et al., 2013
Phenotype of all Fish created by or utilizing MO3-mcamb
Phenotype Fish Conditions Figures
whole organism ab14-ctnnb labeling increased amount, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
neuroectoderm dlx3b expression spatial pattern, abnormal TU + MO3-mcamb control Fig. 5 from Ye et al., 2013
lateral plate mesoderm spaw expression spatial pattern, abnormal TU + MO3-mcamb standard conditions Fig. 3 with image from Gao et al., 2017
thoracic duct prox3 expression decreased amount, abnormal TU + MO3-mcamb standard conditions Fig. S5 with image from Yan et al., 2017
whole organism ventral region vent expression increased distribution, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
notochord increased width, abnormal TU + MO3-mcamb standard conditions Fig. 5 from Ye et al., 2013
Kupffer's vesicle cilium decreased length, abnormal TU + MO3-mcamb standard conditions Fig. 3 with image from Gao et al., 2017
prechordal plate ctslb expression spatial pattern, abnormal TU + MO3-mcamb control Fig. 5 from Ye et al., 2013
somite myod1 expression spatial pattern, abnormal TU + MO3-mcamb control Fig. 5 from Ye et al., 2013
convergent extension process quality, abnormal TU + MO3-mcamb standard conditions Fig. 5 from Ye et al., 2013
whole organism ab21-mapk labeling decreased amount, abnormal TU + MO3-mcamb control Fig. 5 from Ye et al., 2013
thoracic duct lyve1b expression decreased amount, abnormal TU + MO3-mcamb standard conditions Fig. S5 with image from Yan et al., 2017
determination of pancreatic left/right asymmetry decreased occurrence, abnormal TU + MO3-mcamb standard conditions Fig. 4 with image from Gao et al., 2017
heart looping decreased occurrence, abnormal TU + MO3-mcamb standard conditions Fig. 4 with image from Gao et al., 2017
thoracic duct prox1a expression decreased amount, abnormal TU + MO3-mcamb standard conditions Fig. S5 with image from Yan et al., 2017
whole organism dorsal region dharma expression increased amount, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
whole organism axin2 expression decreased amount, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
whole organism dorsal region dharma expression increased distribution, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
somite morphology, abnormal TU + MO3-mcamb standard conditions Fig. 5 from Ye et al., 2013
determination of digestive tract left/right asymmetry decreased occurrence, abnormal TU + MO3-mcamb standard conditions Fig. 4 with image from Gao et al., 2017
notochord tbxta expression spatial pattern, abnormal TU + MO3-mcamb control Fig. 5 from Ye et al., 2013
whole organism ventral region vent expression increased amount, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
whole organism vent expression increased amount, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal TU + MO3-mcamb standard conditions Fig. 3 with image from Gao et al., 2017
whole organism vox expression increased amount, abnormal TU + MO3-mcamb control Fig. 6 from Ye et al., 2013
lateral plate mesoderm right side spaw expression spatial pattern, abnormal TU + MO3-mcamb standard conditions Fig. 3 with image from Gao et al., 2017
epithelial cilium movement involved in determination of left/right asymmetry process quality, abnormal TU + MO3-mcamb standard conditions Fig. 3 with image from Gao et al., 2017
determination of intestine left/right asymmetry decreased occurrence, abnormal TU + MO3-mcamb standard conditions Fig. 4 with image from Gao et al., 2017
intersegmental vessel aplastic, abnormal WT + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
blood circulation disrupted, abnormal WT + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
pericardium edematous, abnormal WT + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
angiogenesis arrested, abnormal WT + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
thoracic duct malformed, abnormal ci5Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
thoracic duct decreased functionality, abnormal ci5Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
whole organism lacks all parts of type parachordal vessel, abnormal la116Tg + MO3-mcamb standard conditions Fig. 6 with image from Tu et al., 2015
vasculature development disrupted, abnormal la116Tg + MO3-mcamb standard conditions Fig. 6 with image from Tu et al., 2015
angiogenesis disrupted, abnormal la116Tg + MO3-mcamb standard conditions Fig. 4 from So et al., 2010
intersegmental vessel decreased length, abnormal la116Tg + MO3-mcamb standard conditions Fig. 4 from So et al., 2010
dorsal longitudinal anastomotic vessel aplastic, abnormal la116Tg + MO3-mcamb standard conditions Fig. 4 from So et al., 2010
Kupffer's vesicle decreased size, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle lumenized, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle anatomical region decreased volume, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle unlumenized, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle tube formation decreased occurrence, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle shape, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
Kupffer's vesicle anatomical space decreased volume, abnormal s870Tg + MO3-mcamb standard conditions Fig. 2 with image from Gao et al., 2017
lymphangiogenesis decreased occurrence, abnormal y1Tg + MO3-mcamb standard conditions Fig. 5 with image from Yan et al., 2017
thoracic duct decreased amount, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
thoracic duct decreased length, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
vascular lymphangioblast absent, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
thoracic duct lymphangiogenesis decreased occurrence, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
thoracic duct absent, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
thoracic duct malformed, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
lymphangiogenic sprout decreased amount, abnormal y1Tg + MO3-mcamb standard conditions Fig. 5 with image from Yan et al., 2017
vascular lymphangioblast lymphangiogenesis decreased occurrence, abnormal y1Tg + MO3-mcamb standard conditions Fig. 6 with image from Yan et al., 2017
blood vessel endothelial cell migration decreased process quality, abnormal is5Tg; y7Tg + MO3-mcamb standard conditions Fig. S6 from Tu et al., 2015
intersegmental vessel endothelial cell decreased amount, abnormal is5Tg; y7Tg + MO3-mcamb standard conditions Fig. 6 with image from Tu et al., 2015
blood vessel endothelial cell proliferation involved in sprouting angiogenesis decreased process quality, abnormal is5Tg; y7Tg + MO3-mcamb standard conditions Fig. S6 from Tu et al., 2015
intersegmental vessel decreased amount, abnormal la116Tg; vu19Tg + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
angiogenesis disrupted, abnormal la116Tg; vu19Tg + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
intersegmental vessel hypoplastic, abnormal la116Tg; vu19Tg + MO3-mcamb standard conditions Fig. 3 from So et al., 2010
Citations