Morpholino

MO2-lgi1a

ID

ZDB-MRPHLNO-101118-2

Name

MO2-lgi1a

Previous Names

MO-E3 (1)

Target

lgi1a (1)

Sequence

5' - ATTTACTGCTGTTACTCACAGATAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-lgi1a

Expressed Gene	Anatomy	Figures
fosab	whole organism	Fig. 6 from Teng et al., 2011
lgi1a	whole organism	Fig. 2 from Teng et al., 2011
lgi1b	whole organism	Fig. 2 from Teng et al., 2011
lgi2a	whole organism	Fig. 2 from Teng et al., 2011
lgi2b	whole organism	Fig. 2 from Teng et al., 2011
lgi3	whole organism	Fig. 2 from Teng et al., 2011

Phenotype

Phenotype resulting from MO2-lgi1a

Phenotype	Fish	Figures
apoptotic process increased occurrence, abnormal	TU + MO2-lgi1a	Fig. 4 from Teng et al., 2010
brain cell decreased amount, abnormal	TU + MO2-lgi1a	Fig. 4 from Teng et al., 2010
eye decreased size, abnormal	TU + MO2-lgi1a	Fig. 2 from Teng et al., 2010
head decreased size, abnormal	TU + MO2-lgi1a	Fig. 2 from Teng et al., 2010
locomotion disrupted, abnormal	TU + MO2-lgi1a	text only from Teng et al., 2010
pericardium edematous, abnormal	TU + MO2-lgi1a	Fig. 2 from Teng et al., 2010
post-vent region curved, abnormal	TU + MO2-lgi1a	Fig. 2 from Teng et al., 2010
regulation of transmission of nerve impulse decreased process quality, abnormal	WT + MO2-lgi1a	Fig. 6 from Teng et al., 2011
trunk decreased length, abnormal	TU + MO2-lgi1a	Fig. 2 from Teng et al., 2010
ventricular system increased size, abnormal	TU + MO2-lgi1a	Fig. 4 from Teng et al., 2010
whole organism decreased size, abnormal	TU + MO2-lgi1a	Fig. 2 from Teng et al., 2010

Phenotype of all Fish created by or utilizing MO2-lgi1a

Phenotype	Fish	Conditions	Figures
eye decreased size, abnormal	TU + MO2-lgi1a	standard conditions	Fig. 2 from Teng et al., 2010
locomotion disrupted, abnormal	TU + MO2-lgi1a	standard conditions	text only from Teng et al., 2010
brain cell decreased amount, abnormal	TU + MO2-lgi1a	standard conditions	Fig. 4 from Teng et al., 2010
larval locomotory behavior disrupted, abnormal	TU + MO2-lgi1a	chemical treatment: pentetrazol	Fig. 3 from Teng et al., 2010
pericardium edematous, abnormal	TU + MO2-lgi1a	standard conditions	Fig. 2 from Teng et al., 2010
ventricular system increased size, abnormal	TU + MO2-lgi1a	standard conditions	Fig. 4 from Teng et al., 2010
head decreased size, abnormal	TU + MO2-lgi1a	standard conditions	Fig. 2 from Teng et al., 2010
post-vent region curved, abnormal	TU + MO2-lgi1a	standard conditions	Fig. 2 from Teng et al., 2010
apoptotic process increased occurrence, abnormal	TU + MO2-lgi1a	standard conditions	Fig. 4 from Teng et al., 2010
trunk decreased length, abnormal	TU + MO2-lgi1a	standard conditions	Fig. 2 from Teng et al., 2010
apoptotic process increased occurrence, abnormal	TU + MO2-lgi1a	chemical treatment: pentetrazol	Fig. 5 from Teng et al., 2010
whole organism decreased size, abnormal	TU + MO2-lgi1a	standard conditions	Fig. 2 from Teng et al., 2010
regulation of transmission of nerve impulse decreased process quality, abnormal	WT + MO2-lgi1a	standard conditions	Fig. 6 from Teng et al., 2011
post-vent region curved ventral, abnormal	WT + MO1-lgi1b + MO2-lgi1a	standard conditions	Fig. 7 from Teng et al., 2011
fourth ventricle hydrocephalic, abnormal	WT + MO1-lgi1b + MO2-lgi1a	standard conditions	Fig. 7 from Teng et al., 2011

Citations