header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-101117-4
Morpholino Name: MO3-foxj1b
Target: foxj1b (1)
Sequence:
5' - ATAAACTGAATTTACCTGCCAGCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a splice blocking morpholino, targeting the splice junction between exons 2 and 3.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-foxj1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-foxj1b
Expressed Gene Anatomy Figures
atoh1b Fig. 6 with image from Yu et al., 2011
PHENOTYPE
Phenotype resulting from MO3-foxj1b
Phenotype of all Fish created by or utilizing MO3-foxj1b
Genome Resources:
CITATIONS (2)