Morpholino

MO2-sox17

ID
ZDB-MRPHLNO-101116-2
Name
MO2-sox17
Previous Names
None
Target
Sequence
5' - CTCATATTTCTGTACTCACCAAGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sox17
Expressed Gene Anatomy Figures
foxj1a Fig. 7 with image from Aamar et al., 2010
ins Fig. 2 with image from Aamar et al., 2010
lft1 Fig. 5 with image from Aamar et al., 2010
lft2 Fig. 5 with image from Aamar et al., 2010
sox32 Fig. 7 with image from Aamar et al., 2010
spaw Fig. 4 with image from Aamar et al., 2010
Phenotype
Phenotype resulting from MO2-sox17
Phenotype Fish Figures
axis decreased length, abnormal WT + MO2-sox17 Fig. 1 with image from Aamar et al., 2010
blood circulation disrupted, abnormal WT + MO2-sox17 Fig. 1 with image from Aamar et al., 2010
brain symmetry, abnormal WT + MO2-sox17 Fig. 5 with image from Aamar et al., 2010
cell death increased occurrence, abnormal WT + MO2-sox17 Fig. 1 with image from Aamar et al., 2010
determination of heart left/right asymmetry disrupted, abnormal WT + MO2-sox17 Fig. 5 with image from Aamar et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO2-sox17 Fig. 4 with image from Aamar et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO2-sox17 Fig. 6 with image from Aamar et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-sox17 Fig. 2 with image from Aamar et al., 2010
endocrine pancreas inverted, abnormal WT + MO2-sox17 Fig. 2 with image from Aamar et al., 2010
extension increased thickness, abnormal WT + MO2-sox17 Fig. 1 with image from Aamar et al., 2010
heart looping disrupted, abnormal WT + MO2-sox17 Fig. S4 with image from Aamar et al., 2010
Kupffer's vesicle bilateral, abnormal WT + MO2-sox17 Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO2-sox17 Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle inverted, abnormal WT + MO2-sox17 Fig. 6 with image from Aamar et al., 2010
pancreas morphology, abnormal WT + MO2-sox17 Fig. 2 with image from Aamar et al., 2010
pericardium edematous, abnormal WT + MO2-sox17 Fig. 1 with image from Aamar et al., 2010
primitive heart tube bilateral, abnormal WT + MO2-sox17 Fig. 5 with image from Aamar et al., 2010
primitive heart tube inverted, abnormal WT + MO2-sox17 Fig. 5 with image from Aamar et al., 2010
somite decreased amount, abnormal WT + MO2-sox17 Fig. 1 with image from Aamar et al., 2010
somitogenesis delayed, abnormal WT + MO2-sox17 Fig. 1 with image from Aamar et al., 2010
Phenotype of all Fish created by or utilizing MO2-sox17
Phenotype Fish Conditions Figures
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-sox17 standard conditions Fig. 2 with image from Aamar et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
somite decreased amount, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
axis decreased length, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
primitive heart tube inverted, abnormal WT + MO2-sox17 standard conditions Fig. 5 with image from Aamar et al., 2010
endocrine pancreas inverted, abnormal WT + MO2-sox17 standard conditions Fig. 2 with image from Aamar et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
cell death increased occurrence, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
Kupffer's vesicle inverted, abnormal WT + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
pancreas morphology, abnormal WT + MO2-sox17 standard conditions Fig. 2 with image from Aamar et al., 2010
Kupffer's vesicle bilateral, abnormal WT + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
extension increased thickness, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
pericardium edematous, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
heart looping disrupted, abnormal WT + MO2-sox17 standard conditions Fig. S4 with image from Aamar et al., 2010
determination of heart left/right asymmetry disrupted, abnormal WT + MO2-sox17 standard conditions Fig. 5 with image from Aamar et al., 2010
brain symmetry, abnormal WT + MO2-sox17 standard conditions Fig. 5 with image from Aamar et al., 2010
primitive heart tube bilateral, abnormal WT + MO2-sox17 standard conditions Fig. 5 with image from Aamar et al., 2010
blood circulation disrupted, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO2-sox17 standard conditions Fig. 4 with image from Aamar et al., 2010
somitogenesis delayed, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle inverted, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle bilateral, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.