header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-101116-2
Morpholino Name: MO2-sox17
Target: sox17 (1)
Sequence:
5' - CTCATATTTCTGTACTCACCAAGCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-sox17 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-sox17
Expressed Gene Anatomy Figures
foxj1a Fig. 7 with image from Aamar et al., 2010
ins Fig. 2 with image from Aamar et al., 2010
lft1 Fig. 5 with image from Aamar et al., 2010
lft2 Fig. 5 with image from Aamar et al., 2010
sox32 Fig. 7 with image from Aamar et al., 2010
spaw Fig. 4 with image from Aamar et al., 2010
PHENOTYPE
Phenotype resulting from MO2-sox17
Phenotype Figures
axis decreased length, abnormal Fig. 1 with image from Aamar et al., 2010
blood circulation disrupted, abnormal Fig. 1 with image from Aamar et al., 2010
brain symmetry, abnormal Fig. 5 with image from Aamar et al., 2010
cell death increased occurrence, abnormal Fig. 1 with image from Aamar et al., 2010
determination of heart left/right asymmetry disrupted, abnormal Fig. 5 with image from Aamar et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal Fig. 4 with image from Aamar et al., 2010
determination of left/right symmetry disrupted, abnormal Fig. 6 with image from Aamar et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal Fig. 2 with image from Aamar et al., 2010
endocrine pancreas inverted, abnormal Fig. 2 with image from Aamar et al., 2010
extension increased thickness, abnormal Fig. 1 with image from Aamar et al., 2010
heart looping disrupted, abnormal Fig. S4 with image from Aamar et al., 2010
Kupffer's vesicle bilateral, abnormal Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle decreased size, abnormal Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle inverted, abnormal Fig. 6 with image from Aamar et al., 2010
pancreas morphology, abnormal Fig. 2 with image from Aamar et al., 2010
pericardium edematous, abnormal Fig. 1 with image from Aamar et al., 2010
primitive heart tube bilateral, abnormal Fig. 5 with image from Aamar et al., 2010
primitive heart tube inverted, abnormal Fig. 5 with image from Aamar et al., 2010
somite decreased amount, abnormal Fig. 1 with image from Aamar et al., 2010
somitogenesis delayed, abnormal Fig. 1 with image from Aamar et al., 2010

Phenotype of all Fish created by or utilizing MO2-sox17
Phenotype Fish Conditions Figures
determination of left/right symmetry disrupted, abnormal WT + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-sox17 standard conditions Fig. 2 with image from Aamar et al., 2010
axis decreased length, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
somite decreased amount, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
primitive heart tube inverted, abnormal WT + MO2-sox17 standard conditions Fig. 5 with image from Aamar et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
endocrine pancreas inverted, abnormal WT + MO2-sox17 standard conditions Fig. 2 with image from Aamar et al., 2010
cell death increased occurrence, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
Kupffer's vesicle inverted, abnormal WT + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
pancreas morphology, abnormal WT + MO2-sox17 standard conditions Fig. 2 with image from Aamar et al., 2010
Kupffer's vesicle bilateral, abnormal WT + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
pericardium edematous, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
extension increased thickness, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
heart looping disrupted, abnormal WT + MO2-sox17 standard conditions Fig. S4 with image from Aamar et al., 2010
determination of heart left/right asymmetry disrupted, abnormal WT + MO2-sox17 standard conditions Fig. 5 with image from Aamar et al., 2010
brain symmetry, abnormal WT + MO2-sox17 standard conditions Fig. 5 with image from Aamar et al., 2010
primitive heart tube bilateral, abnormal WT + MO2-sox17 standard conditions Fig. 5 with image from Aamar et al., 2010
blood circulation disrupted, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO2-sox17 standard conditions Fig. 4 with image from Aamar et al., 2010
somitogenesis delayed, abnormal WT + MO2-sox17 standard conditions Fig. 1 with image from Aamar et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle inverted, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle bilateral, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
Genome Resources:
CITATIONS (1)