Morpholino

MO5-bmp2b

ID

ZDB-MRPHLNO-101112-1

Name

MO5-bmp2b

Previous Names

None

Target

Sequence

5' - CAAATCAGGCCTCACCTTCGTGATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-bmp2b

Expressed Gene	Anatomy	Figures
gdnfa	posterior intestine	FIGURE 7 from Huang et al., 2019
phox2bb	enteric nervous system	FIGURE 8 from Huang et al., 2019

Phenotype

Phenotype resulting from MO5-bmp2b

Phenotype	Fish	Figures
enteric smooth muscle cell differentiation disrupted, abnormal	WT + MO5-bmp2b	FIGURE 4 from Huang et al., 2019
intestine neuron differentiation decreased process quality, abnormal	WT + MO5-bmp2b	FIGURE 6 from Huang et al., 2019
neural crest cell migration involved in autonomic nervous system development decreased process quality, abnormal	WT + MO5-bmp2b	FIGURE 4 from Huang et al., 2019
posterior intestine gdnfa expression decreased amount, abnormal	WT + MO5-bmp2b	FIGURE 7 from Huang et al., 2019
presumptive enteric nervous system morphology, abnormal	zf15Tg + MO5-bmp2b	FIGURE 4 from Huang et al., 2019
vagal neural crest cell population proliferation decreased occurrence, abnormal	zf15Tg + MO5-bmp2b	FIGURE 5 from Huang et al., 2019

Phenotype of all Fish created by or utilizing MO5-bmp2b

Phenotype	Fish	Conditions	Figures
neural crest cell migration involved in autonomic nervous system development decreased process quality, abnormal	WT + MO5-bmp2b	standard conditions	FIGURE 4 from Huang et al., 2019
posterior intestine gdnfa expression decreased amount, abnormal	WT + MO5-bmp2b	standard conditions	FIGURE 7 from Huang et al., 2019
enteric smooth muscle cell differentiation disrupted, abnormal	WT + MO5-bmp2b	standard conditions	FIGURE 4 from Huang et al., 2019
intestine neuron differentiation decreased process quality, abnormal	WT + MO5-bmp2b	standard conditions	FIGURE 6 from Huang et al., 2019
presumptive enteric nervous system morphology, abnormal	zf15Tg + MO5-bmp2b	standard conditions	FIGURE 4 from Huang et al., 2019
vagal neural crest cell population proliferation decreased occurrence, abnormal	zf15Tg + MO5-bmp2b	standard conditions	FIGURE 5 from Huang et al., 2019
neural crest cell migration involved in autonomic nervous system development decreased process quality, abnormal	zf15Tg + MO5-bmp2b	standard conditions	FIGURE 4 from Huang et al., 2019
posterior intestine gdnfa expression amount, ameliorated	fr13Tg + MO5-bmp2b	heat shock	FIGURE 7 from Huang et al., 2019
enteric nervous system phox2bb expression amount, ameliorated	fr13Tg + MO5-bmp2b	heat shock	FIGURE 8 from Huang et al., 2019
enteric nervous system phox2bb expression decreased amount, abnormal	fr13Tg + MO5-bmp2b	control	FIGURE 8 from Huang et al., 2019

Citations