ZFIN ID: ZDB-MRPHLNO-101102-6
Morpholino Name: MO8-fgf3
Target: fgf3 (1)
Sequence:
5' - AAACGGTTTACTCACTTAAAGGGTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO. Targets E2I2 splice junction.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO8-fgf3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO8-fgf3
Expressed Gene Anatomy Figures
fgf10b Fig. 1 with image from Maulding et al., 2014
neurod1 Fig. 9 with image from Maulding et al., 2014
pax2a Fig. 7 with image from Maulding et al., 2014
PHENOTYPE
Phenotype resulting from MO8-fgf3
No data available

Phenotype of all Fish created by or utilizing MO8-fgf3
Phenotype Fish Conditions Figures
otic vesicle formation process quality, abnormal WT + MO8-fgf3 chemical treatment: SB 431542 Fig. 1 with image from Kwon et al., 2009
otic vesicle agenesis, abnormal WT + MO8-fgf3 chemical treatment: SB 431542 Fig. 1 with image from Kwon et al., 2009
OTHER MO8-fgf3 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)