Community Action Needed: Please respond to the NIH RFI
Morpholino

MO8-fgf3

ID
ZDB-MRPHLNO-101102-6
Name
MO8-fgf3
Previous Names
None
Target
Sequence
5' - AAACGGTTTACTCACTTAAAGGGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO. Targets E2I2 splice junction.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO8-fgf3
Phenotype
Phenotype resulting from MO8-fgf3
No data available
Phenotype of all Fish created by or utilizing MO8-fgf3
Citations