Morpholino

MO6-fsta

ID

ZDB-MRPHLNO-101102-5

Name

MO6-fsta

Previous Names

fsta-MO2 E3I3 (1)

Target

fsta (1)

Sequence

5' - TGTGTTACCTACTTTTGCATTTGCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking morpholino targeted to exon3-intron3 junction (E3I3)

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO6-fsta

No data available

Phenotype

Phenotype resulting from MO6-fsta

No data available

Phenotype of all Fish created by or utilizing MO6-fsta

Phenotype	Fish	Conditions	Figures
otic vesicle formation process quality, abnormal	WT + MO1-chrd + MO6-fsta	standard conditions	Fig. 2 from Kwon et al., 2009
otic vesicle decreased size, abnormal	WT + MO1-chrd + MO6-fsta	standard conditions	Fig. 2 from Kwon et al., 2009
otic placode formation process quality, abnormal	WT + MO1-chrd + MO6-fsta	standard conditions	Fig. 2 from Kwon et al., 2009
otic vesicle formation process quality, abnormal	fgf8a^{ti282a/ti282a} + MO1-chrd + MO6-fsta	standard conditions	Fig. 2 from Kwon et al., 2009
otic placode formation process quality, abnormal	fgf8a^{ti282a/ti282a} + MO1-chrd + MO6-fsta	standard conditions	Fig. 2 from Kwon et al., 2009
otic vesicle malformed, abnormal	WT + MO1-chrd + MO2-bmper + MO6-fsta	standard conditions	Fig. 2 from Kwon et al., 2009
otic vesicle formation process quality, abnormal	WT + MO1-chrd + MO2-bmper + MO6-fsta	standard conditions	Fig. 2 from Kwon et al., 2009
otic placode formation process quality, abnormal	WT + MO1-chrd + MO2-bmper + MO6-fsta	standard conditions	Fig. 2 from Kwon et al., 2009
otic vesicle decreased size, abnormal	WT + MO1-chrd + MO2-bmper + MO6-fsta	standard conditions	Fig. 2 from Kwon et al., 2009
trigeminal placode decreased size, abnormal	WT + MO1-chrd + MO2-bmper + MO6-fsta	standard conditions	Fig. 3 from Kwon et al., 2009
inner ear lacks all parts of type otolith, abnormal	WT + MO1-chrd + MO2-bmper + MO6-fsta	standard conditions	Fig. 2 from Kwon et al., 2009
otic placode formation process quality, abnormal	fgf8a^{ti282a/ti282a} + MO1-chrd + MO2-bmper + MO6-fsta	standard conditions	Fig. 2 from Kwon et al., 2009
otic vesicle formation process quality, abnormal	fgf8a^{ti282a/ti282a} + MO1-chrd + MO2-bmper + MO6-fsta	standard conditions	Fig. 2 from Kwon et al., 2009
otic vesicle aplastic, abnormal	fgf8a^{ti282a/ti282a} + MO1-chrd + MO2-bmper + MO6-fsta	standard conditions	Fig. 2 from Kwon et al., 2009

Citations