Morpholino
MO1-ctcf
- ID
- ZDB-MRPHLNO-100824-5
- Name
- MO1-ctcf
- Previous Names
-
- ctcfSplx2
- Target
- Sequence
-
5' - CCAAAACAGATCACAAACCTGAAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ctcf
No data available
Phenotype
Phenotype resulting from MO1-ctcf
| Phenotype | Fish | Figures |
|---|---|---|
| embryo development disrupted, abnormal | WT + MO1-ctcf |
Fig. S2 
from Rhodes et al., 2010 |
| whole organism morphology, abnormal | WT + MO1-ctcf |
Fig. S2
from Rhodes et al., 2010 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-ctcf
1 - 4 of 4
Citations
- Meier, M., Grant, J., Dowdle, A., Thomas, A., Gerton, J., Collas, P., O'Sullivan, J.M., Horsfield, J.A. (2017) Cohesin facilitates zygotic genome activation in zebrafish. Development (Cambridge, England). 145(1)
- Marsman, J., O'Neill, A.C., Kao, B.R., Rhodes, J.M., Meier, M., Antony, J., Mönnich, M., and Horsfield, J.A. (2014) Cohesin and CTCF differentially regulate spatiotemporal runx1 expression during zebrafish development. Biochimica et biophysica acta. Gene regulatory mechanisms. 1839(1):50-61
- Rhodes, J.M., Bentley, F.K., Print, C.G., Dorsett, D., Misulovin, Z., Dickinson, E.J., Crosier, K.E., Crosier, P.S., and Horsfield, J.A. (2010) Positive regulation of c-Myc by cohesin is direct, and evolutionarily conserved. Developmental Biology. 344(2):637-649
1 - 3 of 3
Show