Morpholino

MO2-mibp2

ID
ZDB-MRPHLNO-100824-3
Name
MO2-mibp2
Previous Names
  • nrk2bm2 MO (1)
Target
Sequence
5' - CGTCAAAGTAGAGAAAAATTGGCTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mibp2
No data available
Phenotype
Phenotype resulting from MO2-mibp2
Phenotype Fish Figures
muscle cell undulate, abnormal WT + MO2-mibp2 Fig. 1 with image from Goody et al., 2010
muscle tissue development disrupted, abnormal WT + MO2-mibp2 Fig. 1 with image from Goody et al., 2010
myotome decreased thickness, abnormal WT + MO2-mibp2 Fig. 1 with image from Goody et al., 2010
myotome U-shaped, abnormal WT + MO2-mibp2 Fig. 1 with image from Goody et al., 2010
Phenotype of all Fish created by or utilizing MO2-mibp2
Phenotype Fish Conditions Figures
fast muscle cell muscle tendon junction ab2-fn labeling increased amount, abnormal AB + MO1-mibp2 + MO2-mibp2 control Fig. 2 with image from Jenkins et al., 2016
myotome Ab1-mmp11 labeling increased amount, abnormal AB + MO1-mibp2 + MO2-mibp2 control Fig. 3 with image from Jenkins et al., 2016
myotome muscle tendon junction ab1-lam labeling spatial pattern, abnormal AB + MO1-mibp2 + MO2-mibp2 control Fig. 2 with image from Jenkins et al., 2016
myotome shape, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 8 with image from Goody et al., 2010
muscle cell increased length, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 2 with image from Goody et al., 2010
myotome muscle tendon junction physical object quality, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image,  Fig. 8 with image from Goody et al., 2010
basement membrane assembly disrupted, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 4 with image,  Fig. 5 with image from Goody et al., 2010
protein localization disrupted, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 6 with image from Goody et al., 2010
myotome muscle tendon junction morphology, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 2 with image from Goody et al., 2010
muscle cell undulate, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 1 with image from Goody et al., 2010
protein localization disrupted, abnormal WT + MO1-mibp2 + MO2-mibp2 chemical treatment: pharmaceutical Fig. 6 with image from Goody et al., 2010
somite border shape, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 2 with image from Goody et al., 2010
somite decreased width, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 2 with image from Goody et al., 2010
myotome U-shaped, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 1 with image,  Fig. 3 with image from Goody et al., 2010
myoseptum broken, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image,  Fig. 8 with image from Goody et al., 2010
myoseptum disorganized, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 4 with image,  Fig. 6 with image from Goody et al., 2010
muscle tissue development disrupted, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 1 with image,  Fig. 2 with image from Goody et al., 2010
whole organism decreased length, abnormal WT + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 1 with image,  Fig. 3 with image from Goody et al., 2010
whole organism decreased length, abnormal WT + MO1-mibp2 + MO2-mibp2 + MO9-tp53 standard conditions Fig. 1 with image from Goody et al., 2010
myotome U-shaped, abnormal WT + MO1-mibp2 + MO2-mibp2 + MO9-tp53 standard conditions Fig. 1 with image from Goody et al., 2010
myotome U-shaped, abnormal WT + MO2-mibp2 standard conditions Fig. 1 with image from Goody et al., 2010
muscle tissue development disrupted, abnormal WT + MO2-mibp2 standard conditions Fig. 1 with image from Goody et al., 2010
muscle cell undulate, abnormal WT + MO2-mibp2 standard conditions Fig. 1 with image from Goody et al., 2010
myotome decreased thickness, abnormal WT + MO2-mibp2 standard conditions Fig. 1 with image from Goody et al., 2010
muscle tissue development disrupted, abnormal lamc1ti263a/ti263a + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 2 with image from Goody et al., 2010
somite U-shaped, abnormal lamc1ti263a/ti263a + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 2 with image from Goody et al., 2010
myotome shape, abnormal mai1Tg + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 8 with image from Goody et al., 2010
myotome muscle tendon junction physical object quality, abnormal mai1Tg + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 8 with image from Goody et al., 2010
myoseptum broken, abnormal mai1Tg + MO1-mibp2 + MO2-mibp2 standard conditions Fig. 8 with image from Goody et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.