Morpholino

MO1-dync1h1

ID
ZDB-MRPHLNO-100726-3
Name
MO1-dync1h1
Previous Names
  • dync1h1 ATG MO (1)
Target
Sequence
5' - CGCCGCTGTCAGACATTTCCTACAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocker.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dync1h1
No data available
Phenotype
Phenotype resulting from MO1-dync1h1
Phenotype Fish Figures
brain decreased size, abnormal WT + MO1-dync1h1 + MO4-tp53 Fig. 2 with image from Yang et al., 2015
embryonic retina morphogenesis in camera-type eye process quality, abnormal WT + MO1-dync1h1 Fig. 3 with image from Insinna et al., 2010
eye decreased size, abnormal TL + MO1-dync1h1 Fig. 5 with image from Dona et al., 2015
Fig. 2 with image from Yang et al., 2015
Fig. 3 with image from Insinna et al., 2010
eye photoreceptor cell Golgi apparatus mislocalised, abnormal WT + MO1-dync1h1 Fig. 10 with image from Insinna et al., 2010
eye photoreceptor cell nucleus circular, abnormal WT + MO1-dync1h1 Fig. 8 with image from Insinna et al., 2010
eye photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO1-dync1h1 Fig. 8 with image from Insinna et al., 2010
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-dync1h1 Fig. 5 with image from Dona et al., 2015
eye photoreceptor cell synapse malformed, abnormal WT + MO1-dync1h1 Fig. 11 with image from Insinna et al., 2010
integument melanosome dispersed, abnormal WT + MO1-dync1h1 Figure 5 with image from Zhang et al., 2022
melanocyte distended, abnormal WT + MO1-dync1h1 Fig. 3 with image from Insinna et al., 2010
oligodendrocyte cell division decreased process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 Fig. 3 with image from Yang et al., 2015
oligodendrocyte cell migration decreased process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 Fig. 3 with image from Yang et al., 2015
pericardium edematous, abnormal TL + MO1-dync1h1 Fig. 5 with image from Dona et al., 2015
photoreceptor cell morphogenesis process quality, abnormal WT + MO1-dync1h1 Fig. 3 with imageFig. 8 with imageFig. 13 with image from Insinna et al., 2010
pigmentation process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 Fig. 2 with image from Yang et al., 2015
retinal cone cell organelle mislocalised, abnormal WT + MO1-dync1h1 Fig. 9 with image from Insinna et al., 2010
retinal cone cell photoreceptor outer segment malformed, abnormal WT + MO1-dync1h1 Fig. 9 with image from Insinna et al., 2010
retinal rod cell photoreceptor outer segment physical object quality, abnormal a125Tg + MO1-dync1h1 Fig. 13 with image from Insinna et al., 2010
swim bladder absent, abnormal WT + MO1-dync1h1 + MO4-tp53 Fig. 2 with image from Yang et al., 2015
Phenotype of all Fish created by or utilizing MO1-dync1h1
Phenotype Fish Conditions Figures
pericardium edematous, abnormal TL + MO1-dync1h1 control Fig. 5 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-dync1h1 control Fig. 5 with image from Dona et al., 2015
eye decreased size, abnormal TL + MO1-dync1h1 control Fig. 5 with image from Dona et al., 2015
melanocyte distended, abnormal WT + MO1-dync1h1 standard conditions Fig. 3 with image from Insinna et al., 2010
retinal cone cell organelle mislocalised, abnormal WT + MO1-dync1h1 standard conditions Fig. 9 with image from Insinna et al., 2010
eye photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO1-dync1h1 standard conditions Fig. 8 with image from Insinna et al., 2010
retinal cone cell photoreceptor outer segment malformed, abnormal WT + MO1-dync1h1 standard conditions Fig. 9 with image from Insinna et al., 2010
photoreceptor cell morphogenesis process quality, abnormal WT + MO1-dync1h1 standard conditions Fig. 3 with imageFig. 8 with image from Insinna et al., 2010
eye decreased size, abnormal WT + MO1-dync1h1 standard conditions Fig. 3 with image from Insinna et al., 2010
integument melanosome dispersed, abnormal WT + MO1-dync1h1 control Figure 5 with image from Zhang et al., 2022
embryonic retina morphogenesis in camera-type eye process quality, abnormal WT + MO1-dync1h1 standard conditions Fig. 3 with image from Insinna et al., 2010
eye photoreceptor cell nucleus circular, abnormal WT + MO1-dync1h1 standard conditions Fig. 8 with image from Insinna et al., 2010
eye photoreceptor cell Golgi apparatus mislocalised, abnormal WT + MO1-dync1h1 standard conditions Fig. 10 with image from Insinna et al., 2010
eye photoreceptor cell synapse malformed, abnormal WT + MO1-dync1h1 standard conditions Fig. 11 with image from Insinna et al., 2010
oligodendrocyte cell division decreased process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 3 with image from Yang et al., 2015
brain decreased size, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
oligodendrocyte cell migration decreased process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 3 with image from Yang et al., 2015
pigmentation process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
swim bladder absent, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
eye decreased size, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
photoreceptor cell morphogenesis process quality, abnormal a125Tg + MO1-dync1h1 standard conditions Fig. 13 with image from Insinna et al., 2010
retinal rod cell photoreceptor outer segment physical object quality, abnormal a125Tg + MO1-dync1h1 standard conditions Fig. 13 with image from Insinna et al., 2010
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-dync1h1 + MO1-ninl control Fig. 5 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor inner segment, abnormal TL + MO1-dync1h1 + MO1-ninl control Fig. 5 with image from Dona et al., 2015
whole organism anterior-posterior axis decreased length, abnormal TL + MO1-dync1h1 + MO1-ninl control Fig. 5 with image from Dona et al., 2015
integument melanosome dispersed, abnormal adcy3azf3713/zf3713; adcy5zf3715/zf3715 + MO1-dync1h1 control Figure 5 with image from Zhang et al., 2022
Citations