Morpholino

MO1-bdh2

ID
ZDB-MRPHLNO-100624-6
Name
MO1-bdh2
Previous Names
None
Target
Sequence
5' - GAAGAACTTACTGACAAGTGACAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bdh2
No data available
Phenotype
Phenotype resulting from MO1-bdh2
Phenotype Fish Figures
erythroblast lysosome has extra parts of type erythroblast mitochondrion, abnormal WT + MO1-bdh2 Fig. 4 with image from Davuluri et al., 2016
erythroblast mitochondrion decreased amount, abnormal WT + MO1-bdh2 Fig. 3 with imageFig. 4 with imageFig. 5 with image from Davuluri et al., 2016
erythroblast mitophagy increased occurrence, abnormal WT + MO1-bdh2 Fig. 3 with imageFig. 4 with imageFig. 5 with image from Davuluri et al., 2016
erythroblast mitophagy premature, abnormal WT + MO1-bdh2 Fig. 3 with imageFig. 4 with image from Davuluri et al., 2016
erythroblast nucleus increased size, abnormal WT + MO1-bdh2 Fig. 1 with imageFig. 2 with imageFig. 5 with image from Davuluri et al., 2016
erythrocyte maturation decreased occurrence, abnormal WT + MO1-bdh2 Fig. 2 with imageFig. 5 with image from Davuluri et al., 2016
erythrocyte maturation delayed, abnormal WT + MO1-bdh2 Fig. 1 with image from Davuluri et al., 2016
hemoglobin biosynthetic process decreased occurrence, abnormal WT + MO1-bdh2 Fig. 1 with imageFig. 2 with imageFig. 5 with image from Davuluri et al., 2016
hemoglobin biosynthetic process disrupted, abnormal WT + MO1-bdh2 Fig. 7 with image from Devireddy et al., 2010
nucleate erythrocyte Ab1-TER-119 labeling increased amount, abnormal WT + MO1-bdh2 Fig. 1 with image from Davuluri et al., 2016
nucleate erythrocyte Ab1-tfr1b labeling increased amount, abnormal WT + MO1-bdh2 Fig. 1 with image from Davuluri et al., 2016
nucleate erythrocyte hemoglobin biosynthetic process decreased occurrence, abnormal WT + MO1-bdh2 Fig. 2 with imageFig. 5 with image from Davuluri et al., 2016
nucleate erythrocyte hemoglobin complex decreased amount, abnormal WT + MO1-bdh2 Fig. 7 with image from Devireddy et al., 2010
Phenotype of all Fish created by or utilizing MO1-bdh2
Phenotype Fish Conditions Figures
erythroblast mitochondrion decreased amount, abnormal WT + MO1-bdh2 standard conditions Fig. 3 with imageFig. 4 with imageFig. 5 with image from Davuluri et al., 2016
erythrocyte maturation decreased occurrence, abnormal WT + MO1-bdh2 chemical treatment by injection: desferrioxamine Fig. 2 with image from Davuluri et al., 2016
erythroblast nucleus size, ameliorated WT + MO1-bdh2 chemical treatment by injection: 2,5-dihydroxybenzoic acid Fig. 2 with image from Davuluri et al., 2016
hemoglobin biosynthetic process occurrence, ameliorated WT + MO1-bdh2 chemical treatment by injection: 2,5-dihydroxybenzoic acid Fig. 2 with image from Davuluri et al., 2016
hemoglobin biosynthetic process decreased occurrence, abnormal WT + MO1-bdh2 chemical treatment by injection: benzoic acid Fig. 2 with image from Davuluri et al., 2016
hemoglobin biosynthetic process disrupted, abnormal WT + MO1-bdh2 standard conditions Fig. 7 with image from Devireddy et al., 2010
erythrocyte maturation delayed, abnormal WT + MO1-bdh2 standard conditions Fig. 1 with image from Davuluri et al., 2016
nucleate erythrocyte hemoglobin biosynthetic process decreased occurrence, abnormal WT + MO1-bdh2 chemical treatment by injection: desferrioxamine Fig. 2 with image from Davuluri et al., 2016
nucleate erythrocyte Ab1-TER-119 labeling increased amount, abnormal WT + MO1-bdh2 standard conditions Fig. 1 with image from Davuluri et al., 2016
erythroblast lysosome has extra parts of type erythroblast mitochondrion, abnormal WT + MO1-bdh2 standard conditions Fig. 4 with image from Davuluri et al., 2016
nucleate erythrocyte hemoglobin complex decreased amount, abnormal WT + MO1-bdh2 standard conditions Fig. 7 with image from Devireddy et al., 2010
erythroblast nucleus increased size, abnormal WT + MO1-bdh2 chemical treatment by injection: desferrioxamine Fig. 2 with image from Davuluri et al., 2016
erythroblast mitophagy premature, abnormal WT + MO1-bdh2 standard conditions Fig. 3 with imageFig. 4 with image from Davuluri et al., 2016
hemoglobin biosynthetic process decreased occurrence, abnormal WT + MO1-bdh2 standard conditions Fig. 1 with imageFig. 2 with imageFig. 5 with image from Davuluri et al., 2016
hemoglobin biosynthetic process decreased occurrence, abnormal WT + MO1-bdh2 chemical treatment by injection: desferrioxamine Fig. 2 with image from Davuluri et al., 2016
nucleate erythrocyte Ab1-tfr1b labeling increased amount, abnormal WT + MO1-bdh2 standard conditions Fig. 1 with image from Davuluri et al., 2016
erythroblast nucleus increased size, abnormal WT + MO1-bdh2 chemical treatment by injection: benzoic acid Fig. 2 with image from Davuluri et al., 2016
nucleate erythrocyte hemoglobin biosynthetic process decreased occurrence, abnormal WT + MO1-bdh2 control Fig. 2 with imageFig. 5 with image from Davuluri et al., 2016
erythrocyte maturation decreased occurrence, abnormal WT + MO1-bdh2 control Fig. 2 with imageFig. 5 with image from Davuluri et al., 2016
erythroblast mitophagy increased occurrence, abnormal WT + MO1-bdh2 standard conditions Fig. 3 with imageFig. 4 with imageFig. 5 with image from Davuluri et al., 2016
erythrocyte maturation decreased occurrence, abnormal WT + MO1-bdh2 chemical treatment by injection: benzoic acid Fig. 2 with image from Davuluri et al., 2016
erythroblast nucleus increased size, abnormal WT + MO1-bdh2 standard conditions Fig. 1 with imageFig. 2 with imageFig. 5 with image from Davuluri et al., 2016
nucleate erythrocyte hemoglobin biosynthetic process decreased occurrence, abnormal WT + MO1-bdh2 chemical treatment by injection: benzoic acid Fig. 2 with image from Davuluri et al., 2016
erythrocyte maturation occurrence, ameliorated WT + MO1-bdh2 chemical treatment by injection: 2,5-dihydroxybenzoic acid Fig. 2 with image from Davuluri et al., 2016
nucleate erythrocyte hemoglobin biosynthetic process occurrence, ameliorated WT + MO1-bdh2 chemical treatment by injection: 2,5-dihydroxybenzoic acid Fig. 2 with image from Davuluri et al., 2016
erythrocyte maturation occurrence, ameliorated WT + MO1-bdh2 + MO3-atg7 standard conditions Fig. 5 with image from Davuluri et al., 2016
erythroblast mitochondrion amount, ameliorated WT + MO1-bdh2 + MO3-atg7 standard conditions Fig. 5 with image from Davuluri et al., 2016
nucleate erythrocyte hemoglobin biosynthetic process occurrence, ameliorated WT + MO1-bdh2 + MO3-atg7 standard conditions Fig. 5 with image from Davuluri et al., 2016
erythroblast mitophagy occurrence, ameliorated WT + MO1-bdh2 + MO3-atg7 standard conditions Fig. 5 with image from Davuluri et al., 2016
hemoglobin biosynthetic process occurrence, ameliorated WT + MO1-bdh2 + MO3-atg7 standard conditions Fig. 5 with image from Davuluri et al., 2016
erythroblast nucleus size, ameliorated WT + MO1-bdh2 + MO3-atg7 standard conditions Fig. 5 with image from Davuluri et al., 2016
Citations