Morpholino

MO1-dre-mir-143-1

ID
ZDB-MRPHLNO-100622-5
Name
MO1-dre-mir-143-1
Previous Names
  • MO1-mir143
  • multi-blocker mir-143 (1)
Target
Sequence
5' - CGAGCTACAGTGCTTCATCTCAGACTCCCAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dre-mir-143-1
Expressed Gene Anatomy Figures
alcama Fig. 4 with image,  Fig. 7 with image from Deacon et al., 2010
aldh1a2 Fig. 4 with image from Miyasaka et al., 2011
bmp4 Fig. S6 with image from Miyasaka et al., 2011
has2 Fig. S6 with image from Miyasaka et al., 2011
myh6 Fig. 5 with image from Miyasaka et al., 2011
nppa Fig. 4 with image from Deacon et al., 2010
rxrab Fig. 4 with image from Miyasaka et al., 2011
Phenotype
Phenotype resulting from MO1-dre-mir-143-1
Phenotype Fish Figures
atrium dilated, abnormal f1Tg + MO1-dre-mir-143-1 Fig. 2 with image from Deacon et al., 2010
atrium swollen, abnormal WT + MO1-dre-mir-143-1 Fig. 3 with image from Miyasaka et al., 2011
blood circulation decreased rate, abnormal f1Tg + MO1-dre-mir-143-1 Fig. 2 with image from Deacon et al., 2010
brain hypoplastic, abnormal WT + MO1-dre-mir-143-1 Fig. 3 with image from Miyasaka et al., 2011
cardiac muscle cell actin filament bundle decreased thickness, abnormal WT + MO1-dre-mir-143-1 Fig. 5 with image from Miyasaka et al., 2011
cardiac ventricle collapsed, abnormal f1Tg + MO1-dre-mir-143-1 Fig. 2 with image from Deacon et al., 2010
cardiac ventricle decreased contractility, abnormal f1Tg + MO1-dre-mir-143-1 Fig. 2 with image from Deacon et al., 2010
cardiac ventricle cardiac muscle cell circular, abnormal f1Tg + MO1-dre-mir-143-1 Fig. 4 with image from Deacon et al., 2010
cardiac ventricle cardiac muscle cell decreased size, abnormal f1Tg + MO1-dre-mir-143-1 Fig. 4 with image from Deacon et al., 2010
embryonic heart tube morphogenesis decreased process quality, abnormal f1Tg + MO1-dre-mir-143-1 Fig. 4 with image from Deacon et al., 2010
heart contraction disrupted, abnormal y1Tg + MO1-dre-mir-143-1 Fig. 3 with image from Miyasaka et al., 2011
heart looping disrupted, abnormal y1Tg + MO1-dre-mir-143-1 Fig. 3 with image from Miyasaka et al., 2011
nucleate erythrocyte accumulation ball, abnormal WT + MO1-dre-mir-143-1 Fig. 3 with image from Miyasaka et al., 2011
pericardium edematous, abnormal WT + MO1-dre-mir-143-1 Fig. 3 with image from Miyasaka et al., 2011
regulation of actin cytoskeleton organization decreased process quality, abnormal WT + MO1-dre-mir-143-1 Fig. 7 with image from Deacon et al., 2010
ventricular myocardium filamentous actin mislocalised, abnormal WT + MO1-dre-mir-143-1 Fig. 7 with image from Deacon et al., 2010
Phenotype of all Fish created by or utilizing MO1-dre-mir-143-1
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO1-dre-mir-143-1 standard conditions Fig. 3 with image from Miyasaka et al., 2011
nucleate erythrocyte accumulation ball, abnormal WT + MO1-dre-mir-143-1 standard conditions Fig. 3 with image from Miyasaka et al., 2011
ventricular myocardium filamentous actin mislocalised, abnormal WT + MO1-dre-mir-143-1 standard conditions Fig. 7 with image from Deacon et al., 2010
cardiac muscle cell actin filament bundle decreased thickness, abnormal WT + MO1-dre-mir-143-1 standard conditions Fig. 5 with image from Miyasaka et al., 2011
atrium swollen, abnormal WT + MO1-dre-mir-143-1 standard conditions Fig. 3 with image from Miyasaka et al., 2011
regulation of actin cytoskeleton organization decreased process quality, abnormal WT + MO1-dre-mir-143-1 standard conditions Fig. 7 with image from Deacon et al., 2010
brain hypoplastic, abnormal WT + MO1-dre-mir-143-1 standard conditions Fig. 3 with image from Miyasaka et al., 2011
cardiac ventricle decreased contractility, abnormal f1Tg + MO1-dre-mir-143-1 standard conditions Fig. 2 with image from Deacon et al., 2010
cardiac ventricle cardiac muscle cell decreased size, abnormal f1Tg + MO1-dre-mir-143-1 standard conditions Fig. 4 with image from Deacon et al., 2010
cardiac ventricle cardiac muscle cell circular, abnormal f1Tg + MO1-dre-mir-143-1 standard conditions Fig. 4 with image from Deacon et al., 2010
atrium dilated, abnormal f1Tg + MO1-dre-mir-143-1 standard conditions Fig. 2 with image from Deacon et al., 2010
blood circulation decreased rate, abnormal f1Tg + MO1-dre-mir-143-1 standard conditions Fig. 2 with image from Deacon et al., 2010
embryonic heart tube morphogenesis decreased process quality, abnormal f1Tg + MO1-dre-mir-143-1 standard conditions Fig. 4 with image from Deacon et al., 2010
cardiac ventricle collapsed, abnormal f1Tg + MO1-dre-mir-143-1 standard conditions Fig. 2 with image from Deacon et al., 2010
heart looping disrupted, abnormal y1Tg + MO1-dre-mir-143-1 standard conditions Fig. 3 with image from Miyasaka et al., 2011
heart contraction disrupted, abnormal y1Tg + MO1-dre-mir-143-1 standard conditions Fig. 3 with image from Miyasaka et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.