Morpholino
MO1-etv5a
- ID
- ZDB-MRPHLNO-100621-4
- Name
- MO1-etv5a
- Previous Names
- None
- Target
- Sequence
-
5' - ATACATTAGGGAGTACCTGTAGCTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-etv5a
No data available
Phenotype
Phenotype resulting from MO1-etv5a
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO1-etv5a
1 - 5 of 29 Show all
Citations
- Marra, A.N., Adeeb, B.D., Chambers, B.E., Drummond, B.E., Ulrich, M., Addiego, A., Springer, M., Poureetezadi, S.J., Chambers, J.M., Ronshaugen, M., Wingert, R.A. (2019) Prostaglandin signaling regulates renal multiciliated cell specification and maturation. Proceedings of the National Academy of Sciences of the United States of America. 116(17):8409-8418
- Marra, A.N., Cheng, C.N., Adeeb, B., Addiego, A., Wesselman, H.M., Chambers, B.E., Chambers, J.M., Wingert, R.A. (2019) Iroquois transcription factor irx2a is required for multiciliated and transporter cell fate decisions during zebrafish pronephros development. Scientific Reports. 9:6454
- Marra, A.N., Wingert, R.A. (2016) Epithelial cell fate in the nephron tubule is mediated by the ETS transcription factors etv5a and etv4 during zebrafish kidney development. Developmental Biology. 411(2):231-45
- Mao, J., McGlinn, E., Huang, P., Tabin, C.J., and McMahon, A.P. (2009) Fgf-dependent Etv4/5 activity is required for posterior restriction of Sonic Hedgehog and promoting outgrowth of the vertebrate limb. Developmental Cell. 16(4):600-606
1 - 4 of 4
Show