Morpholino

MO1-rest

ID

ZDB-MRPHLNO-100614-4

Name

MO1-rest

Previous Names

None

Target

rest (1)

Sequence

5' - GGCCTTTCACCTGTAAAATACAGAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rest

Expressed Gene	Anatomy	Figures
dbx1a	whole organism	Fig. 2 from Gates et al., 2010
epha4a	rhombomere 5	Fig. 5 from Mapp et al., 2011
foxa2	hindbrain neural tube ventral region pharyngeal endoderm whole organism	Fig. 2 from Gates et al., 2010
gli1	hindbrain neural tube ventral region	Fig. 6 from Gates et al., 2010
gli2a	forebrain hindbrain hindbrain neural tube ventral region midbrain ventricular zone	Fig. 6 , Fig. S6 from Gates et al., 2010
gli3	hindbrain neural tube	Fig. 6 from Gates et al., 2010
nkx2.2a	diencephalon forebrain hindbrain neural tube ventral region midbrain pancreatic bud spinal cord neural tube ventral region whole organism	Fig. 2 , Fig. 4 , Fig. 5 , Fig. 7 , Fig. 8 , Fig. S3 , Fig. S6 from Gates et al., 2010
pax3a	hindbrain neural tube dorsal region whole organism	Fig. 2 , Fig. 4 from Gates et al., 2010
ptch2	diencephalon midbrain neural tube whole organism	Fig. 2 , Fig. 7 from Gates et al., 2010
rest	facial nerve motor nucleus nucleus (not) hindbrain neuron	Fig. S6 from Mapp et al., 2011

Phenotype

Phenotype resulting from MO1-rest

Phenotype	Fish	Figures
dorsal/ventral neural tube patterning disrupted, abnormal	WT + MO1-rest	Fig. 2 from Gates et al., 2010
embryo development decreased rate, abnormal	WT + MO1-rest	text only from Gates et al., 2010
facial nerve motor nucleus mislocalised anteriorly, abnormal	rw0Tg + MO1-rest	Fig. 5 from Mapp et al., 2011
neural tube wholly ventralized, abnormal	WT + MO1-rest	Fig. 2 from Gates et al., 2010
neuron migration process quality, abnormal	rw0Tg + MO1-rest	Fig. 5 from Mapp et al., 2011
regulation of smoothened signaling pathway disrupted, abnormal	WT + MO1-rest	Fig. 2 from Gates et al., 2010
smoothened signaling pathway involved in dorsal/ventral neural tube patterning disrupted, abnormal	WT + MO1-rest	Fig. 2 from Gates et al., 2010
whole organism decreased size, abnormal	WT + MO1-rest	text only from Gates et al., 2010

Phenotype of all Fish created by or utilizing MO1-rest

Phenotype	Fish	Conditions	Figures
neural tube wholly ventralized, abnormal	WT + MO1-rest	standard conditions	Fig. 2 from Gates et al., 2010
regulation of smoothened signaling pathway disrupted, abnormal	WT + MO1-rest	standard conditions	Fig. 2 from Gates et al., 2010
smoothened signaling pathway involved in dorsal/ventral neural tube patterning disrupted, abnormal	WT + MO1-rest	standard conditions	Fig. 2 from Gates et al., 2010
embryo development decreased rate, abnormal	WT + MO1-rest	standard conditions	text only from Gates et al., 2010
whole organism decreased size, abnormal	WT + MO1-rest	standard conditions	text only from Gates et al., 2010
dorsal/ventral neural tube patterning disrupted, abnormal	WT + MO1-rest	standard conditions	Fig. 2 from Gates et al., 2010
neuron migration process quality, abnormal	rw0Tg + MO1-rest	standard conditions	Fig. 5 from Mapp et al., 2011
facial nerve motor nucleus mislocalised anteriorly, abnormal	rw0Tg + MO1-rest	standard conditions	Fig. 5 from Mapp et al., 2011
facial nerve motor nucleus motor neuron migration decreased occurrence, abnormal	rw0Tg + MO1-rest + MO5-rest	control	Fig. 1 from Love et al., 2015
rhombomere 6 has fewer parts of type facial nerve motor nucleus motor neuron, abnormal	rw0Tg + MO1-rest + MO5-rest	control	Fig. 1 from Love et al., 2015
facial nerve motor nucleus motor neuron displaced to rhombomere 4, abnormal	rw0Tg + MO1-rest + MO5-rest	control	Fig. 1 from Love et al., 2015
facial nerve motor nucleus motor neuron displaced to rhombomere 5, abnormal	rw0Tg + MO1-rest + MO5-rest	control	Fig. 1 from Love et al., 2015

Citations