Morpholino
MO2-klf2a
- ID
- ZDB-MRPHLNO-100610-9
- Name
- MO2-klf2a
- Previous Names
-
- klf2a splice blocking (1)
- Target
- Sequence
-
5' - CTCGCCTATGAAAGAAGAGAGGATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-klf2a
No data available
Phenotype
Phenotype resulting from MO2-klf2a
No data available
Phenotype of all Fish created by or utilizing MO2-klf2a
from 1 - 2 of 2
Citations
- Paolini, A., Sharipova, D., Lange, T., Abdelilah-Seyfried, S. (2023) Wnt9 directs zebrafish heart tube assembly via a combination of canonical and non-canonical pathway signaling. Development (Cambridge, England). 150(18):
- Donat, S., Lourenço, M., Paolini, A., Otten, C., Renz, M., Abdelilah-Seyfried, S. (2018) Heg1 and Ccm1/2 proteins control endocardial mechanosensitivity during zebrafish valvulogenesis. eLIFE. 7:e28939
- Samsa, L.A., Givens, C., Tzima, E., Stainier, D.Y., Qian, L., Liu, J. (2015) Cardiac contraction activates endocardial Notch signaling to modulate chamber maturation in zebrafish. Development (Cambridge, England). 142:4080-91
- Dietrich, A.C., Lombardo, V.A., Abdelilah-Seyfried, S. (2014) Blood Flow and Bmp Signaling Control Endocardial Chamber Morphogenesis. Developmental Cell. 30:367-377
- Nicoli, S., Standley, C., Walker, P., Hurlstone, A., Fogarty, K.E., and Lawson, N.D. (2010) MicroRNA-mediated integration of haemodynamics and Vegf signalling during angiogenesis. Nature. 464(7292):1196-1200
1 - 5 of 5
Show