Morpholino
MO6-ackr3b
- ID
- ZDB-MRPHLNO-100512-6
- Name
- MO6-ackr3b
- Previous Names
-
- MO6-cxcr7b
- Target
- Sequence
-
5' - TCATTCACGTTCACACTCATCTTGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-ackr3b
No data available
Phenotype
Phenotype resulting from MO6-ackr3b
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO6-ackr3b
1 - 5 of 12 Show all
Citations
- Neelathi, U.M., Dalle Nogare, D., Chitnis, A.B. (2018) Cxcl12a induces snail1b expression to initiate collective migration and sequential Fgf-dependent neuromast formation in the zebrafish posterior lateral line primordium.. Development (Cambridge, England). 145(14):
- Breau, M.A., Wilson, D., Wilkinson, D.G., and Xu, Q. (2012) Chemokine and Fgf signalling act as opposing guidance cues in formation of the lateral line primordium. Development (Cambridge, England). 139(12):2246-2253
- Olesnicky Killian, E.C., Birkholz, D.A., and Artinger, K.B. (2009) A role for chemokine signaling in neural crest cell migration and craniofacial development. Developmental Biology. 333(1):161-172
- Dambly-Chaudière, C., Cubedo, N., and Ghysen, A. (2007) Control of cell migration in the development of the posterior lateral line: antagonistic interactions between the chemokine receptors CXCR4 and CXCR7/RDC1. BMC Developmental Biology. 7:23
- Valentin, G., Haas, P., and Gilmour, D. (2007) The chemokine SDF1a coordinates tissue migration through the spatially restricted activation of Cxcr7 and Cxcr4b. Current biology : CB. 17(12):1026-1031
1 - 5 of 5
Show