Morpholino

MO2-pak1

ID
ZDB-MRPHLNO-100507-2
Name
MO2-pak1
Previous Names
None
Target
Sequence
5' - GCATCACTCACTCTTGTCTCCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pak1
No data available
Phenotype
Phenotype resulting from MO2-pak1
Phenotype Fish Figures
atrium morphology, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
blood accumulation heart, abnormal sd2Tg + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
blood circulation decreased process quality, abnormal sd2Tg + MO2-pak1 Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 4 with image from Kelly et al., 2014
bulbus arteriosus morphology, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
bulbus arteriosus development process quality, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
ceratohyal cartilage morphology, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
head decreased size, abnormal WT + MO2-pak1 Fig. 3 with imageFig. 4 with image from Kelly et al., 2014
head cell death increased process quality, abnormal WT + MO2-pak1 Fig. 1 with image from Kelly et al., 2014
heart morphology, abnormal WT + MO2-pak1 Fig. 1 with image from Kelly et al., 2014
heart looping decreased process quality, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
Meckel's cartilage morphology, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
melanocyte decreased amount, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
melanocyte neural crest cell migration process quality, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
neural crest cell migration process quality, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
pericardium edematous, abnormal WT + MO2-pak1 Fig. 1 with imageFig. 3 with image from Kelly et al., 2014
pharyngeal arch morphology, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
pigmentation decreased process quality, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
whole organism curved, abnormal WT + MO2-pak1 Fig. 1 with imageFig. 3 with imageFig. 4 with image from Kelly et al., 2014
whole organism lacks parts or has fewer parts of type portion of tissue, abnormal WT + MO2-pak1 Fig. 1 with image from Kelly et al., 2014
Phenotype of all Fish created by or utilizing MO2-pak1
Phenotype Fish Conditions Figures
atrium morphology, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
blood circulation decreased process quality, abnormal WT + MO2-pak1 standard conditions Fig. 1 with imageFig. 3 with imageFig. 4 with image from Kelly et al., 2014
whole organism curved, abnormal WT + MO2-pak1 standard conditions Fig. 1 with imageFig. 3 with imageFig. 4 with image from Kelly et al., 2014
pharyngeal arch morphology, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
neural crest cell migration process quality, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
heart looping decreased process quality, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
whole organism lacks parts or has fewer parts of type portion of tissue, abnormal WT + MO2-pak1 standard conditions Fig. 1 with image from Kelly et al., 2014
pericardium edematous, abnormal WT + MO2-pak1 standard conditions Fig. 1 with imageFig. 3 with image from Kelly et al., 2014
head cell death increased process quality, abnormal WT + MO2-pak1 standard conditions Fig. 1 with image from Kelly et al., 2014
heart morphology, abnormal WT + MO2-pak1 standard conditions Fig. 1 with image from Kelly et al., 2014
pigmentation decreased process quality, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
head decreased size, abnormal WT + MO2-pak1 standard conditions Fig. 3 with imageFig. 4 with image from Kelly et al., 2014
bulbus arteriosus development process quality, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
ceratohyal cartilage morphology, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
melanocyte decreased amount, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
Meckel's cartilage morphology, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
melanocyte neural crest cell migration process quality, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
bulbus arteriosus morphology, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
blood circulation decreased process quality, abnormal sd2Tg + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
blood accumulation heart, abnormal sd2Tg + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
heart looping decreased process quality, abnormal twu34Tg + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
Citations