Morpholino

MO2-mkxa

ID
ZDB-MRPHLNO-100506-5
Name
MO2-mkxa
Previous Names
  • Irxl1-MOII (1)
Target
Sequence
5' - CCAGTTAGACACCTGAAAATAAAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mkxa
Phenotype
Phenotype resulting from MO2-mkxa
Phenotype Fish Figures
brain malformed, abnormal WT + MO2-mkxa Fig. 5 with image from Chuang et al., 2010
brain morphogenesis process quality, abnormal WT + MO2-mkxa Fig. 5 with image from Chuang et al., 2010
ceratobranchial cartilage decreased amount, abnormal WT + MO2-mkxa Fig. 8 with image from Chuang et al., 2010
ceratobranchial cartilage malformed, abnormal WT + MO2-mkxa Fig. 8 with image from Chuang et al., 2010
ceratohyal cartilage malformed, abnormal WT + MO2-mkxa Fig. 8 with image from Chuang et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO2-mkxa Fig. 6 with imageFig. 8 with image from Chuang et al., 2010
extraocular musculature decreased amount, abnormal WT + MO2-mkxa Fig. 6 with image from Chuang et al., 2010
eye decreased size, abnormal WT + MO2-mkxa Fig. 4 with image from Chuang et al., 2010
head decreased size, abnormal WT + MO2-mkxa Fig. 4 with image from Chuang et al., 2010
head flat, abnormal WT + MO2-mkxa Fig. 4 with image from Chuang et al., 2010
locomotion involved in locomotory behavior process quality, abnormal WT + MO2-mkxa Fig. 4 with image from Chuang et al., 2010
mandibular arch skeleton malformed, abnormal WT + MO2-mkxa Fig. 4 with image from Chuang et al., 2010
Meckel's cartilage decreased size, abnormal WT + MO2-mkxa Fig. 8 with image from Chuang et al., 2010
neural crest physical object quality, abnormal WT + MO2-mkxa Fig. 7 with image from Chuang et al., 2010
palatoquadrate cartilage decreased size, abnormal WT + MO2-mkxa Fig. 8 with image from Chuang et al., 2010
pharyngeal arch cartilage physical object quality, abnormal WT + MO2-mkxa Fig. 6 with image from Chuang et al., 2010
pharyngeal musculature decreased amount, abnormal WT + MO2-mkxa Fig. 6 with image from Chuang et al., 2010
post-vent region curved dorsal, abnormal WT + MO2-mkxa Fig. 4 with image from Chuang et al., 2010
ventricular system malformed, abnormal WT + MO2-mkxa Fig. 5 with image from Chuang et al., 2010
Phenotype of all Fish created by or utilizing MO2-mkxa
Phenotype Fish Conditions Figures
ceratohyal cartilage malformed, abnormal WT + MO2-mkxa standard conditions Fig. 8 with image from Chuang et al., 2010
palatoquadrate cartilage decreased size, abnormal WT + MO2-mkxa standard conditions Fig. 8 with image from Chuang et al., 2010
eye decreased size, abnormal WT + MO2-mkxa standard conditions Fig. 4 with image from Chuang et al., 2010
ventricular system malformed, abnormal WT + MO2-mkxa standard conditions Fig. 5 with image from Chuang et al., 2010
brain malformed, abnormal WT + MO2-mkxa standard conditions Fig. 5 with image from Chuang et al., 2010
ceratobranchial cartilage decreased amount, abnormal WT + MO2-mkxa standard conditions Fig. 8 with image from Chuang et al., 2010
pharyngeal musculature decreased amount, abnormal WT + MO2-mkxa standard conditions Fig. 6 with image from Chuang et al., 2010
extraocular musculature decreased amount, abnormal WT + MO2-mkxa standard conditions Fig. 6 with image from Chuang et al., 2010
head flat, abnormal WT + MO2-mkxa standard conditions Fig. 4 with image from Chuang et al., 2010
neural crest physical object quality, abnormal WT + MO2-mkxa standard conditions Fig. 7 with image from Chuang et al., 2010
ceratobranchial cartilage malformed, abnormal WT + MO2-mkxa standard conditions Fig. 8 with image from Chuang et al., 2010
locomotion involved in locomotory behavior process quality, abnormal WT + MO2-mkxa standard conditions Fig. 4 with image from Chuang et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO2-mkxa standard conditions Fig. 6 with imageFig. 8 with image from Chuang et al., 2010
mandibular arch skeleton malformed, abnormal WT + MO2-mkxa standard conditions Fig. 4 with image from Chuang et al., 2010
head decreased size, abnormal WT + MO2-mkxa standard conditions Fig. 4 with image from Chuang et al., 2010
pharyngeal arch cartilage physical object quality, abnormal WT + MO2-mkxa standard conditions Fig. 6 with image from Chuang et al., 2010
post-vent region curved dorsal, abnormal WT + MO2-mkxa standard conditions Fig. 4 with image from Chuang et al., 2010
brain morphogenesis process quality, abnormal WT + MO2-mkxa standard conditions Fig. 5 with image from Chuang et al., 2010
Meckel's cartilage decreased size, abnormal WT + MO2-mkxa standard conditions Fig. 8 with image from Chuang et al., 2010
Citations