Morpholino

MO1-mkxa

ID
ZDB-MRPHLNO-100506-4
Name
MO1-mkxa
Previous Names
  • Irxl1-MOI (1)
Target
Sequence
5' - GTGTTCATCTTTGGTATATTAGTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mkxa
No data available
Phenotype
Phenotype resulting from MO1-mkxa
Phenotype Fish Figures
brain malformed, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 5 with image from Chuang et al., 2010
brain morphogenesis process quality, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 5 with image from Chuang et al., 2010
cephalic musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 9 with image from Chuang et al., 2010
ceratobranchial cartilage decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 8 with image from Chuang et al., 2010
ceratobranchial cartilage malformed, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 8 with image from Chuang et al., 2010
ceratohyal cartilage malformed, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 8 with image from Chuang et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 6 with image,  Fig. 8 with image from Chuang et al., 2010
extraocular musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 6 with image from Chuang et al., 2010
Meckel's cartilage decreased size, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 8 with image from Chuang et al., 2010
neural crest physical object quality, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 7 with image from Chuang et al., 2010
palatoquadrate cartilage decreased size, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 8 with image from Chuang et al., 2010
pharyngeal arch cartilage physical object quality, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 6 with image from Chuang et al., 2010
pharyngeal musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 6 with image from Chuang et al., 2010
pharyngeal pouch disorganized, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 6 with image from Chuang et al., 2010
skeletal muscle cell irregular spatial pattern, abnormal AB + MO1-mkxa + MO4-tp53 Fig. 1,  Fig. 11 from Chuang et al., 2014
somite actin filament decondensed, abnormal AB + MO1-mkxa + MO4-tp53 Fig. 1 from Chuang et al., 2014
somite actin filament disorganized, abnormal AB + MO1-mkxa + MO4-tp53 Fig. 1 from Chuang et al., 2014
somite focal adhesion decreased amount, abnormal AB + MO1-mkxa + MO4-tp53 Fig. 1 from Chuang et al., 2014
thigmotaxis disrupted, abnormal AB + MO1-mkxa + MO4-tp53 Fig. 1 from Chuang et al., 2014
ventricular system malformed, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 5 with image from Chuang et al., 2010
whole organism curved, abnormal AB + MO1-mkxa + MO4-tp53 Fig. 1,  Fig. 11 from Chuang et al., 2014
whole organism anterior-posterior axis decreased length, abnormal AB + MO1-mkxa + MO4-tp53 Fig. 1,  Fig. 11 from Chuang et al., 2014
Phenotype of all Fish created by or utilizing MO1-mkxa
Phenotype Fish Conditions Figures
somite focal adhesion decreased amount, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
skeletal muscle cell irregular spatial pattern, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
whole organism curved, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
somite actin filament disorganized, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
thigmotaxis disrupted, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
whole organism anterior-posterior axis decreased length, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
somite actin filament decondensed, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
neural crest physical object quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 7 with image from Chuang et al., 2010
pharyngeal pouch disorganized, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
ceratobranchial cartilage malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
extraocular musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
skeletal muscle cell irregular spatial pattern, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 11 from Chuang et al., 2014
Meckel's cartilage decreased size, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
brain morphogenesis process quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 5 with image from Chuang et al., 2010
whole organism curved, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 11 from Chuang et al., 2014
ceratohyal cartilage malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
ventricular system malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 5 with image from Chuang et al., 2010
pharyngeal musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 11 from Chuang et al., 2014
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image,  Fig. 8 with image from Chuang et al., 2010
ceratobranchial cartilage decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
pharyngeal arch cartilage physical object quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
brain malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 5 with image from Chuang et al., 2010
palatoquadrate cartilage decreased size, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
cephalic musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 9 with image from Chuang et al., 2010
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-mkxa + MO4-tp53 + MO6-myod1 standard conditions Fig. 11 from Chuang et al., 2014
post-vent region deformed, abnormal WT + MO1-mkxa + MO4-tp53 + MO6-myod1 standard conditions Fig. 11 from Chuang et al., 2014
whole organism curved, abnormal WT + MO1-mkxa + MO4-tp53 + MO6-myod1 standard conditions Fig. 11 from Chuang et al., 2014
skeletal muscle cell morphology, abnormal WT + MO1-mkxa + MO4-tp53 + MO6-myod1 standard conditions Fig. 11 from Chuang et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.