Morpholino

MO2-grk3

ID

ZDB-MRPHLNO-100505-1

Name

MO2-grk3

Previous Names

MO2-adrbk2

Target

grk3 (1)

Sequence

5' - ATGGCTGGAAAGAGAGCAAACAAAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice blocking MO

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-grk3

Expressed Gene	Anatomy	Figures
gata1a	hematopoietic system	Fig. 4 from Jiang et al., 2009
grk3	whole organism	Fig. 4 from Jiang et al., 2009
otx2b	midbrain	Fig. 4 from Jiang et al., 2009
pax6a	immature eye	Fig. 4 from Jiang et al., 2009

Phenotype

Phenotype resulting from MO2-grk3

Phenotype	Fish	Figures
blood circulation disrupted, abnormal	AB + MO2-grk3	Fig. S6 , text only from Jiang et al., 2009
cell cycle process disrupted, abnormal	AB + MO2-grk3	Fig. 4 from Jiang et al., 2009
embryo development arrested, abnormal	AB + MO2-grk3	Fig. 4 from Jiang et al., 2009
eye decreased size, abnormal	AB + MO2-grk3	text only from Jiang et al., 2009
head increased size, abnormal	AB + MO2-grk3	text only from Jiang et al., 2009
heart malformed, abnormal	AB + MO2-grk3	Fig. S6 from Jiang et al., 2009
heart contraction decreased intensity, abnormal	AB + MO2-grk3	Fig. S6 from Jiang et al., 2009
heart development disrupted, abnormal	AB + MO2-grk3	Fig. S6 from Jiang et al., 2009
heart looping disrupted, abnormal	AB + MO2-grk3	Fig. S6 from Jiang et al., 2009
heart tube elongated, abnormal	AB + MO2-grk3	Fig. S6 from Jiang et al., 2009
pericardium edematous, abnormal	AB + MO2-grk3	Fig. S6 , text only from Jiang et al., 2009
pigmentation disrupted, abnormal	AB + MO2-grk3	text only from Jiang et al., 2009
post-vent region coiled, abnormal	AB + MO2-grk3	text only from Jiang et al., 2009
somite development disrupted, abnormal	AB + MO2-grk3	Fig. S5 from Jiang et al., 2009
whole organism decreased length, abnormal	AB + MO2-grk3	text only from Jiang et al., 2009
whole organism malformed, abnormal	AB + MO2-grk3	text only from Jiang et al., 2009

Phenotype of all Fish created by or utilizing MO2-grk3

Phenotype	Fish	Conditions	Figures
heart malformed, abnormal	AB + MO2-grk3	standard conditions	Fig. S6 from Jiang et al., 2009
blood circulation disrupted, abnormal	AB + MO2-grk3	standard conditions	Fig. S6 , text only from Jiang et al., 2009
eye decreased size, abnormal	AB + MO2-grk3	standard conditions	text only from Jiang et al., 2009
post-vent region coiled, abnormal	AB + MO2-grk3	standard conditions	text only from Jiang et al., 2009
heart tube elongated, abnormal	AB + MO2-grk3	standard conditions	Fig. S6 from Jiang et al., 2009
embryo development arrested, abnormal	AB + MO2-grk3	standard conditions	Fig. 4 from Jiang et al., 2009
heart development disrupted, abnormal	AB + MO2-grk3	standard conditions	Fig. S6 from Jiang et al., 2009
heart contraction decreased intensity, abnormal	AB + MO2-grk3	standard conditions	Fig. S6 from Jiang et al., 2009
heart looping disrupted, abnormal	AB + MO2-grk3	standard conditions	Fig. S6 from Jiang et al., 2009
whole organism malformed, abnormal	AB + MO2-grk3	standard conditions	text only from Jiang et al., 2009
pericardium edematous, abnormal	AB + MO2-grk3	standard conditions	Fig. S6 , text only from Jiang et al., 2009
pigmentation disrupted, abnormal	AB + MO2-grk3	standard conditions	text only from Jiang et al., 2009
head increased size, abnormal	AB + MO2-grk3	standard conditions	text only from Jiang et al., 2009
somite development disrupted, abnormal	AB + MO2-grk3	standard conditions	Fig. S5 from Jiang et al., 2009
cell cycle process disrupted, abnormal	AB + MO2-grk3	standard conditions	Fig. 4 from Jiang et al., 2009
whole organism decreased length, abnormal	AB + MO2-grk3	standard conditions	text only from Jiang et al., 2009

Citations